Transcript: Human XM_017021436.2

PREDICTED: Homo sapiens Rho guanine nucleotide exchange factor 40 (ARHGEF40), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARHGEF40 (55701)
Length:
4237
CDS:
573..3002

Additional Resources:

NCBI RefSeq record:
XM_017021436.2
NBCI Gene record:
ARHGEF40 (55701)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021436.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436386 TGGAACAGCTGACTCGGTATG pLKO_005 2053 CDS 100% 6.000 8.400 N ARHGEF40 n/a
2 TRCN0000433037 AGAAGGTGCTGGATATCTTTG pLKO_005 982 CDS 100% 10.800 7.560 N ARHGEF40 n/a
3 TRCN0000135758 CCAACTGAACTCTGTGGATTT pLKO.1 324 5UTR 100% 10.800 7.560 N ARHGEF40 n/a
4 TRCN0000437114 GGATCTGGACGTCAAGCAAAT pLKO_005 2789 CDS 100% 10.800 7.560 N ARHGEF40 n/a
5 TRCN0000163368 GCCACATTGCTTGCCTTCATA pLKO.1 3214 3UTR 100% 5.625 3.938 N ARHGEF40 n/a
6 TRCN0000161681 GCTGTCAGAGAATGATCTGAA pLKO.1 359 5UTR 100% 0.495 0.347 N ARHGEF40 n/a
7 TRCN0000423630 TGTTTACAAGCAGGCCTTTAA pLKO_005 2369 CDS 100% 13.200 7.920 N ARHGEF40 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021436.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12256 pDONR223 100% 40.2% 40.2% None 1_1437del;2245_2256del n/a
2 ccsbBroad304_12256 pLX_304 0% 40.2% 40.2% V5 1_1437del;2245_2256del n/a
3 TRCN0000473647 CTTTGCAATACGACTTCTAGGTGT pLX_317 45.4% 40.2% 40.2% V5 1_1437del;2245_2256del n/a
4 ccsbBroadEn_12257 pDONR223 98.6% 40.2% 40.1% None 1_1437del;2110A>C;2245_2256del n/a
5 ccsbBroad304_12257 pLX_304 0% 40.2% 40.1% V5 (not translated due to prior stop codon) 1_1437del;2110A>C;2245_2256del n/a
Download CSV