Transcript: Human XM_017021620.2

PREDICTED: Homo sapiens TNF receptor associated factor 3 (TRAF3), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRAF3 (7187)
Length:
1245
CDS:
227..1105

Additional Resources:

NCBI RefSeq record:
XM_017021620.2
NBCI Gene record:
TRAF3 (7187)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021620.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221069 CGTGTCAAGAGAGCATCGTTA pLKO.1 495 CDS 100% 4.950 6.930 N TRAF3 n/a
2 TRCN0000358690 CACGTGGAGAAGGCGTGTAAA pLKO_005 719 CDS 100% 13.200 9.240 N TRAF3 n/a
3 TRCN0000358760 TCGTTAAAGATAAGGTGTTTA pLKO_005 510 CDS 100% 13.200 9.240 N TRAF3 n/a
4 TRCN0000221072 GAGCAGTTAATGCTGGGACAT pLKO.1 602 CDS 100% 4.050 2.835 N TRAF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021620.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroad304_07098 pLX_304 26.5% 50.7% 66.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_07098 pDONR223 100% 50.4% 48.7% None (many diffs) n/a
3 TRCN0000476352 ACAACCACCACATGATTTTCTTCC pLX_317 21.1% 50.4% 48.7% V5 (many diffs) n/a
Download CSV