Transcript: Human XM_017021657.2

PREDICTED: Homo sapiens L-2-hydroxyglutarate dehydrogenase (L2HGDH), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
L2HGDH (79944)
Length:
2211
CDS:
638..1483

Additional Resources:

NCBI RefSeq record:
XM_017021657.2
NBCI Gene record:
L2HGDH (79944)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021657.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000444686 GCACTCCTGATCCTCGAATTG pLKO_005 906 CDS 100% 10.800 15.120 N L2HGDH n/a
2 TRCN0000421181 GACTTTACTCAGACCGTATTT pLKO_005 870 CDS 100% 13.200 10.560 N L2HGDH n/a
3 TRCN0000426990 GATCCAGCAGGAGGATATAAA pLKO_005 510 5UTR 100% 15.000 10.500 N L2HGDH n/a
4 TRCN0000423101 AGTATAGATGGAATGCAATAT pLKO_005 785 CDS 100% 13.200 9.240 N L2HGDH n/a
5 TRCN0000437277 CCAGACTTCAGGCCCTATATG pLKO_005 452 5UTR 100% 13.200 9.240 N L2HGDH n/a
6 TRCN0000064324 CGCATTCTTCATGTGAGAAAT pLKO.1 1382 CDS 100% 13.200 9.240 N L2HGDH n/a
7 TRCN0000064325 GCAACAGTGAAGTATCTTCAA pLKO.1 1229 CDS 100% 4.950 3.465 N L2HGDH n/a
8 TRCN0000064326 GCTTTGTCATTTGCCCAGGAT pLKO.1 686 CDS 100% 2.640 1.848 N L2HGDH n/a
9 TRCN0000064327 GTGGTGTCATACATAGTGGAA pLKO.1 293 5UTR 100% 2.640 1.848 N L2HGDH n/a
10 TRCN0000064323 CCACAGATGTTATGGATATAA pLKO.1 1125 CDS 100% 15.000 9.000 N L2HGDH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021657.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12647 pDONR223 100% 52.7% 46.2% None (many diffs) n/a
2 ccsbBroad304_12647 pLX_304 0% 52.7% 46.2% V5 (many diffs) n/a
3 TRCN0000471907 AGTACCTCGTGCCTCGACAAATCA pLX_317 36.4% 52.7% 46.2% V5 (many diffs) n/a
Download CSV