Transcript: Human XM_017021667.1

PREDICTED: Homo sapiens nucleotide binding protein like (NUBPL), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NUBPL (80224)
Length:
3049
CDS:
400..936

Additional Resources:

NCBI RefSeq record:
XM_017021667.1
NBCI Gene record:
NUBPL (80224)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021667.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419822 CCTTTAGAAATCACGAGTTTA pLKO_005 1196 3UTR 100% 13.200 18.480 N NUBPL n/a
2 TRCN0000149758 GCAGTTATCAGTCTCACAGAA pLKO.1 549 CDS 100% 4.950 6.930 N NUBPL n/a
3 TRCN0000412429 GACATTCCCTTACACCTTAAT pLKO_005 793 CDS 100% 13.200 10.560 N NUBPL n/a
4 TRCN0000253196 TTGGAGAGGCCTTATGGTAAT pLKO_005 441 CDS 100% 10.800 7.560 N Nubpl n/a
5 TRCN0000146540 GCCAAAGCTTACTTGAGGATT pLKO.1 874 CDS 100% 4.950 3.465 N NUBPL n/a
6 TRCN0000128303 GCTTGGATTTGAACTTGAGTA pLKO.1 1693 3UTR 100% 4.950 2.970 N NUBPL n/a
7 TRCN0000131136 GCAGTGAATCTTGCACTTGCA pLKO.1 269 5UTR 100% 2.640 1.584 N NUBPL n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1798 3UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 1864 3UTR 100% 13.200 6.600 Y IQCC n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1799 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021667.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12686 pDONR223 100% 61.4% 61.2% None 0_1ins333;170A>C n/a
2 ccsbBroad304_12686 pLX_304 0% 61.4% 61.2% V5 0_1ins333;170A>C n/a
3 TRCN0000492280 AAAACTATACCCAGTACGAGCCAT pLX_317 50.2% 61.4% 61.2% V5 0_1ins333;170A>C n/a
Download CSV