Transcript: Human XM_017021786.2

PREDICTED: Homo sapiens ribosomal protein S6 kinase A5 (RPS6KA5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RPS6KA5 (9252)
Length:
3241
CDS:
905..2656

Additional Resources:

NCBI RefSeq record:
XM_017021786.2
NBCI Gene record:
RPS6KA5 (9252)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021786.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001498 CGCGGTGGAAATCATGAAGAA pLKO.1 2146 CDS 100% 4.950 6.930 N RPS6KA5 n/a
2 TRCN0000195329 CCGGATATTCTAGGATCTTCC pLKO.1 2348 CDS 100% 4.050 5.670 N RPS6KA5 n/a
3 TRCN0000001496 GCAGATTTATGTTGGAGAGAT pLKO.1 641 5UTR 100% 4.950 3.960 N RPS6KA5 n/a
4 TRCN0000196479 GAAGCTTGTTTCAGCTGTAAG pLKO.1 1825 CDS 100% 10.800 7.560 N RPS6KA5 n/a
5 TRCN0000196766 GTTTGGGTGTTCTAATGTATG pLKO.1 966 CDS 100% 10.800 7.560 N RPS6KA5 n/a
6 TRCN0000001497 GCTGAGAAGGTGGGAATAGAA pLKO.1 300 5UTR 100% 5.625 3.938 N RPS6KA5 n/a
7 TRCN0000001495 GCACCATTTAAGCCAGTCATT pLKO.1 1244 CDS 100% 4.950 3.465 N RPS6KA5 n/a
8 TRCN0000379468 AGCAACCTTCCACGCCTTTAA pLKO_005 2395 CDS 100% 13.200 7.920 N RPS6KA5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021786.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02123 pDONR223 100% 41.1% 41% None 0_1ins657;988_991delAATTinsG;994_1749del n/a
2 ccsbBroad304_02123 pLX_304 0% 41.1% 41% V5 0_1ins657;988_991delAATTinsG;994_1749del n/a
3 TRCN0000466446 TCTTTACTTTACGTCATCATTACA pLX_317 26.9% 41.1% 41% V5 0_1ins657;988_991delAATTinsG;994_1749del n/a
4 ccsbBroadEn_14934 pDONR223 0% 41.1% 41% None 0_1ins657;988_991delAATTinsG;994_1749del n/a
5 ccsbBroad304_14934 pLX_304 0% 41.1% 41% V5 0_1ins657;988_991delAATTinsG;994_1749del n/a
6 TRCN0000480681 TACACAATAACACTCCCGACAATC pLX_317 26.9% 41.1% 41% V5 0_1ins657;988_991delAATTinsG;994_1749del n/a
Download CSV