Transcript: Human XM_017021856.1

PREDICTED: Homo sapiens secretory carrier membrane protein 2 (SCAMP2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SCAMP2 (10066)
Length:
2521
CDS:
347..1168

Additional Resources:

NCBI RefSeq record:
XM_017021856.1
NBCI Gene record:
SCAMP2 (10066)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021856.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370730 GTCTACACTGGATAATCATTC pLKO_005 931 CDS 100% 10.800 15.120 N SCAMP2 n/a
2 TRCN0000156233 CCTTTAGGTCCGACAACTCTT pLKO.1 804 CDS 100% 4.950 6.930 N SCAMP2 n/a
3 TRCN0000150604 GATATGCAAGATGCTCTACTA pLKO.1 619 CDS 100% 4.950 6.930 N SCAMP2 n/a
4 TRCN0000323384 GATATGCAAGATGCTCTACTA pLKO_005 619 CDS 100% 4.950 6.930 N SCAMP2 n/a
5 TRCN0000155523 GCAGAACACTGTAGCCAACTT pLKO.1 496 CDS 100% 4.950 6.930 N SCAMP2 n/a
6 TRCN0000323305 GCAGAACACTGTAGCCAACTT pLKO_005 496 CDS 100% 4.950 6.930 N SCAMP2 n/a
7 TRCN0000154550 GCGGATATGCAAGATGCTCTA pLKO.1 616 CDS 100% 4.050 5.670 N SCAMP2 n/a
8 TRCN0000377596 GCCCTGCTTCTATCAGGATTT pLKO_005 568 CDS 100% 10.800 7.560 N SCAMP2 n/a
9 TRCN0000323385 TTTCCGTGGGTGCCTTATGTG pLKO_005 1224 3UTR 100% 4.950 3.465 N SCAMP2 n/a
10 TRCN0000152907 GATGCTCTACTATCTGTGGAT pLKO.1 628 CDS 100% 2.640 1.848 N SCAMP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021856.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02302 pDONR223 100% 81.8% 79% None (many diffs) n/a
2 ccsbBroad304_02302 pLX_304 0% 81.8% 79% V5 (many diffs) n/a
3 TRCN0000468503 TTAGGTAGAGGGGTCTGCACTTTG pLX_317 33.2% 81.8% 79% V5 (many diffs) n/a
Download CSV