Transcript: Human XM_017021860.1

PREDICTED: Homo sapiens RAS guanyl releasing protein 1 (RASGRP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RASGRP1 (10125)
Length:
4956
CDS:
250..2499

Additional Resources:

NCBI RefSeq record:
XM_017021860.1
NBCI Gene record:
RASGRP1 (10125)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021860.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048270 CGGGAAAGTGAACGTCCATAA pLKO.1 1230 CDS 100% 10.800 15.120 N RASGRP1 n/a
2 TRCN0000048268 CGCCTGATTGACACAACTCAA pLKO.1 604 CDS 100% 4.950 6.930 N RASGRP1 n/a
3 TRCN0000435495 GACGTTATCCCTGGATCTTTA pLKO_005 1344 CDS 100% 13.200 9.240 N RASGRP1 n/a
4 TRCN0000424672 ACAATCTGTAGATGAGTATAG pLKO_005 2517 3UTR 100% 10.800 7.560 N RASGRP1 n/a
5 TRCN0000433297 TGCTGACCATGCACCGAATTG pLKO_005 371 CDS 100% 10.800 7.560 N RASGRP1 n/a
6 TRCN0000048272 CCTTGTAAATAGCTGTGTGAA pLKO.1 801 CDS 100% 4.950 3.465 N RASGRP1 n/a
7 TRCN0000048271 GCCCTAAAGATCCAACTGAAA pLKO.1 2395 CDS 100% 4.950 3.465 N RASGRP1 n/a
8 TRCN0000048269 GCTGCCTCTAAAGCAAGACTA pLKO.1 163 5UTR 100% 4.950 3.465 N RASGRP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021860.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489632 TATCATGCTGACCCAAGCCCCCGG pLX_317 14.8% 93.9% 93.9% V5 (not translated due to prior stop codon) 0_1ins144 n/a
Download CSV