Transcript: Human XM_017021932.1

PREDICTED: Homo sapiens family with sequence similarity 81 member A (FAM81A), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM81A (145773)
Length:
3499
CDS:
189..1322

Additional Resources:

NCBI RefSeq record:
XM_017021932.1
NBCI Gene record:
FAM81A (145773)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021932.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144462 CCGTCAGAAGTATGATGTAAA pLKO.1 2299 3UTR 100% 13.200 18.480 N FAM81A n/a
2 TRCN0000121964 CCGTCTATGAAAGCATAGGAT pLKO.1 1207 CDS 100% 0.300 0.420 N FAM81A n/a
3 TRCN0000145069 CTATGGAACTAATTCTGCCTT pLKO.1 548 CDS 100% 2.640 2.112 N FAM81A n/a
4 TRCN0000144642 GCCATAGTGAAGCAACTTAAT pLKO.1 477 CDS 100% 13.200 9.240 N FAM81A n/a
5 TRCN0000144570 GAGGAGCATATCAGAAACATA pLKO.1 453 CDS 100% 5.625 3.938 N FAM81A n/a
6 TRCN0000121947 CCACCTAGATATTACAGGTTT pLKO.1 1996 3UTR 100% 4.950 3.465 N FAM81A n/a
7 TRCN0000139129 CGAATCACCAAGCTGGAGTTA pLKO.1 1131 CDS 100% 4.950 3.465 N FAM81A n/a
8 TRCN0000140186 GCAAGATGTGATGCCAGCATA pLKO.1 624 CDS 100% 4.950 3.465 N FAM81A n/a
9 TRCN0000139629 CGGGACAACATTAGCTATGGA pLKO.1 534 CDS 100% 3.000 2.100 N FAM81A n/a
10 TRCN0000181630 GCTATGGAACTAATTCTGCCT pLKO.1 547 CDS 100% 0.660 0.462 N Fam81a n/a
11 TRCN0000121971 CCACCATTTATGTAATGGAAA pLKO.1 1890 3UTR 100% 0.495 0.347 N FAM81A n/a
12 TRCN0000144483 CCCACCATTTATGTAATGGAA pLKO.1 1889 3UTR 100% 0.300 0.210 N FAM81A n/a
13 TRCN0000144019 CCAAACTTATCTTGGAAACGA pLKO.1 715 CDS 100% 3.000 1.800 N FAM81A n/a
14 TRCN0000144918 GCTTTCCTTGATTGTTAAGGA pLKO.1 974 CDS 100% 0.300 0.180 N FAM81A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021932.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10479 pDONR223 100% 96.1% 95.7% None (many diffs) n/a
2 ccsbBroad304_10479 pLX_304 0% 96.1% 95.7% V5 (many diffs) n/a
3 TRCN0000477726 AACGTCGCCGTGAGGATTGATTAT pLX_317 37% 96.1% 63.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV