Transcript: Human XM_017021963.1

PREDICTED: Homo sapiens cilia and flagella associated protein 161 (CFAP161), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CFAP161 (161502)
Length:
1653
CDS:
181..1011

Additional Resources:

NCBI RefSeq record:
XM_017021963.1
NBCI Gene record:
CFAP161 (161502)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021963.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167903 CCGTAACTGAAGATGGCTATA pLKO.1 275 CDS 100% 10.800 15.120 N CFAP161 n/a
2 TRCN0000167929 CAGGAAGTGTACCTAACAGAT pLKO.1 640 CDS 100% 4.950 3.960 N CFAP161 n/a
3 TRCN0000167191 CCTCTACTTATATCCTTCATT pLKO.1 1280 3UTR 100% 5.625 3.938 N CFAP161 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021963.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05110 pDONR223 100% 91.6% 91.6% None 0_1ins75 n/a
2 ccsbBroad304_05110 pLX_304 0% 91.6% 91.6% V5 0_1ins75 n/a
3 TRCN0000479972 TCTGCCTGTCGATCGAATCTACTG pLX_317 39.3% 91.6% 91.6% V5 0_1ins75 n/a
Download CSV