Transcript: Human XM_017022009.2

PREDICTED: Homo sapiens FES proto-oncogene, tyrosine kinase (FES), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FES (2242)
Length:
2889
CDS:
203..2671

Additional Resources:

NCBI RefSeq record:
XM_017022009.2
NBCI Gene record:
FES (2242)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022009.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231680 ATCAGCAGACACGGGAGTTTG pLKO_005 2499 CDS 100% 10.800 15.120 N FES n/a
2 TRCN0000361154 ATCAGCAGACACGGGAGTTTG pLKO_005 2499 CDS 100% 10.800 15.120 N Fes n/a
3 TRCN0000199154 CAACAGGAGCTCCGGAATGAA pLKO.1 1205 CDS 100% 5.625 7.875 N FES n/a
4 TRCN0000010529 GATAACCTGTACCGACTGGAA pLKO.1 1730 CDS 100% 2.640 3.696 N FES n/a
5 TRCN0000000626 CTTGGATAACCTGTACCGACT pLKO.1 1726 CDS 100% 2.160 3.024 N FES n/a
6 TRCN0000199061 CGGCTCCAGCTCATATGCTGA pLKO.1 2729 3UTR 100% 0.000 0.000 N FES n/a
7 TRCN0000255348 TGCAGGAATACCTGGAGATTA pLKO_005 882 CDS 100% 13.200 9.240 N FES n/a
8 TRCN0000380695 ACAAGGCTAAGGACAAGTATG pLKO_005 699 CDS 100% 10.800 7.560 N FES n/a
9 TRCN0000231678 ACCCACGCTGGAGATCCTTAA pLKO_005 1465 CDS 100% 10.800 7.560 N FES n/a
10 TRCN0000231676 CTACTGGAGGGCATGAGAAAG pLKO_005 278 CDS 100% 10.800 7.560 N FES n/a
11 TRCN0000231679 CTGACCTCAAGGCCAAGTTTC pLKO_005 1995 CDS 100% 10.800 7.560 N FES n/a
12 TRCN0000379569 TGGTGTTGGGTGAGCAGATTG pLKO_005 1884 CDS 100% 10.800 7.560 N FES n/a
13 TRCN0000369029 CAGAAGCAGCCCATCTACATC pLKO_005 2084 CDS 100% 4.950 3.465 N FES n/a
14 TRCN0000000627 GAGAAGAATGTCCTGAAGATC pLKO.1 2279 CDS 100% 4.950 3.465 N FES n/a
15 TRCN0000000624 CAAGGCCAAGTTTCTACAGGA pLKO.1 2002 CDS 100% 2.640 1.848 N FES n/a
16 TRCN0000000625 CATTCCTTTGCTCATCGACCA pLKO.1 1768 CDS 100% 2.160 1.512 N FES n/a
17 TRCN0000199245 CTTCTCAAGCTGGTGGCCTCT pLKO.1 2684 3UTR 100% 0.720 0.504 N FES n/a
18 TRCN0000196932 GCTCATATGCTGACAGCTCTT pLKO.1 2737 3UTR 100% 0.000 0.000 N FES n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022009.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14637 pDONR223 0% 99.9% 100% None 504T>C n/a
2 ccsbBroad304_14637 pLX_304 0% 99.9% 100% V5 504T>C n/a
3 TRCN0000479440 CCTAATGATTTCCCATTACAGGGA pLX_317 12.8% 99.9% 100% V5 504T>C;2466delG n/a
4 TRCN0000491795 CTCAGGGGGTATCAGACGTGAACA pLX_317 7.6% 99.9% 100% V5 (not translated due to prior stop codon) 15C>T;504T>C n/a
Download CSV