Transcript: Human XM_017022059.2

PREDICTED: Homo sapiens gamma-aminobutyric acid type A receptor gamma3 subunit (GABRG3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GABRG3 (2567)
Length:
9721
CDS:
416..1483

Additional Resources:

NCBI RefSeq record:
XM_017022059.2
NBCI Gene record:
GABRG3 (2567)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022059.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419361 CAACGTCTGCAGGTGATTATG pLKO_005 780 CDS 100% 13.200 18.480 N GABRG3 n/a
2 TRCN0000063055 CCTTCGATTCAACAGCACAAT pLKO.1 397 5UTR 100% 4.950 3.960 N GABRG3 n/a
3 TRCN0000063057 GCTGCTATGAAGAATGTAAAT pLKO.1 1335 CDS 100% 13.200 9.240 N GABRG3 n/a
4 TRCN0000063053 CCAGAAATCATGGCGGCTTTA pLKO.1 715 CDS 100% 10.800 7.560 N GABRG3 n/a
5 TRCN0000063056 CCTGAGCGAATAAGCCTACAA pLKO.1 1172 CDS 100% 4.950 3.465 N GABRG3 n/a
6 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 2718 3UTR 100% 10.800 5.400 Y MRPS16 n/a
7 TRCN0000164801 CCTCCCAAAGTACTGGGATTA pLKO.1 6698 3UTR 100% 1.080 0.540 Y MAPKAPK5-AS1 n/a
8 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 2718 3UTR 100% 10.800 5.400 Y CD3EAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022059.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.