Transcript: Human XM_017022393.2

PREDICTED: Homo sapiens zinc finger and SCAN domain containing 2 (ZSCAN2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZSCAN2 (54993)
Length:
1027
CDS:
226..726

Additional Resources:

NCBI RefSeq record:
XM_017022393.2
NBCI Gene record:
ZSCAN2 (54993)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022393.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015843 AGGTGCCTCAAGAGGAAGATA pLKO.1 278 CDS 100% 5.625 3.938 N ZSCAN2 n/a
2 TRCN0000234683 GATGACTCCTGGGTGCAAGAA pLKO_005 334 CDS 100% 4.950 3.465 N ZSCAN2 n/a
3 TRCN0000015845 GATGTTAACCATGCTGCCAAA pLKO.1 516 CDS 100% 4.050 2.835 N ZSCAN2 n/a
4 TRCN0000015846 CGCTGGCTGAGACCAGAGGTA pLKO.1 481 CDS 100% 0.000 0.000 N ZSCAN2 n/a
5 TRCN0000234684 CACCAAGGAGCAGATGTTAAC pLKO_005 504 CDS 100% 10.800 6.480 N ZSCAN2 n/a
6 TRCN0000015847 TGCCAAAGGAAATTCAGGCTT pLKO.1 530 CDS 100% 2.640 1.584 N ZSCAN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022393.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08444 pDONR223 100% 88% 82% None (many diffs) n/a
2 ccsbBroad304_08444 pLX_304 0% 88% 82% V5 (many diffs) n/a
3 TRCN0000467418 AATCTCTAACTGCCTTATGGTTAG pLX_317 85.5% 88% 82% V5 (many diffs) n/a
Download CSV