Transcript: Human XM_017022397.1

PREDICTED: Homo sapiens HAUS augmin like complex subunit 2 (HAUS2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HAUS2 (55142)
Length:
3913
CDS:
314..739

Additional Resources:

NCBI RefSeq record:
XM_017022397.1
NBCI Gene record:
HAUS2 (55142)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022397.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147449 GAATATACTCAAGTGGCGTAA pLKO.1 586 CDS 100% 4.050 5.670 N HAUS2 n/a
2 TRCN0000417310 CTTTAGCAAAGATGGATATAT pLKO_005 537 CDS 100% 15.000 10.500 N HAUS2 n/a
3 TRCN0000150261 GAAACCCACCTTGAAACAATT pLKO.1 470 CDS 100% 13.200 9.240 N HAUS2 n/a
4 TRCN0000150175 GTTGACTGTAACATGGGTATT pLKO.1 793 3UTR 100% 10.800 7.560 N HAUS2 n/a
5 TRCN0000147010 CTGGAAATTGAACTCCTGAAA pLKO.1 135 5UTR 100% 4.950 3.465 N HAUS2 n/a
6 TRCN0000147428 GATACAGCAGATGTTGTTCAT pLKO.1 165 5UTR 100% 4.950 3.465 N HAUS2 n/a
7 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1364 3UTR 100% 4.950 2.475 Y ERAP2 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1365 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022397.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08475 pDONR223 100% 59.8% 59.5% None 0_1ins282;412A>T n/a
2 ccsbBroad304_08475 pLX_304 0% 59.8% 59.5% V5 0_1ins282;412A>T n/a
3 TRCN0000476041 ATCCAGATAGCGCTCACCACGGAA pLX_317 41.7% 59.8% 59.5% V5 0_1ins282;412A>T n/a
Download CSV