Transcript: Human XM_017022635.2

PREDICTED: Homo sapiens SPG11 vesicle trafficking associated, spatacsin (SPG11), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPG11 (80208)
Length:
5372
CDS:
32..4834

Additional Resources:

NCBI RefSeq record:
XM_017022635.2
NBCI Gene record:
SPG11 (80208)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022635.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000343941 CATAATGCATGGGCAATATAA pLKO_005 1201 CDS 100% 15.000 21.000 N SPG11 n/a
2 TRCN0000343877 TATTGGCATAGGCCTAAATTT pLKO_005 2194 CDS 100% 15.000 21.000 N SPG11 n/a
3 TRCN0000343875 AGCCGTATTGGAGGTGTAATA pLKO_005 2924 CDS 100% 13.200 18.480 N SPG11 n/a
4 TRCN0000129138 GCTCGGCAATTAGAGAAAGTT pLKO.1 1803 CDS 100% 5.625 4.500 N SPG11 n/a
5 TRCN0000146437 CCAGGATAAGTCCAGAAGAAT pLKO.1 2634 CDS 100% 5.625 3.938 N SPG11 n/a
6 TRCN0000148925 CCCAAAGTAAAGGAGAGCAAT pLKO.1 2054 CDS 100% 4.950 3.465 N SPG11 n/a
7 TRCN0000353030 CCCAAAGTAAAGGAGAGCAAT pLKO_005 2054 CDS 100% 4.950 3.465 N SPG11 n/a
8 TRCN0000149987 CCAGGAATTAATCAAGAGCAA pLKO.1 3682 CDS 100% 2.640 1.584 N SPG11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022635.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12682 pDONR223 100% 47.1% 46.9% None (many diffs) n/a
2 ccsbBroad304_12682 pLX_304 0% 47.1% 46.9% V5 (many diffs) n/a
3 TRCN0000469170 GTTCGGTCACCCGGCATAATACCT pLX_317 14.1% 47.1% 46.9% V5 (many diffs) n/a
Download CSV