Transcript: Human XM_017022691.2

PREDICTED: Homo sapiens protein inhibitor of activated STAT 1 (PIAS1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PIAS1 (8554)
Length:
4516
CDS:
246..2174

Additional Resources:

NCBI RefSeq record:
XM_017022691.2
NBCI Gene record:
PIAS1 (8554)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022691.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257327 ACCCAGTCCATCCGGATATAA pLKO_005 607 CDS 100% 15.000 12.000 N PIAS1 n/a
2 TRCN0000004146 CATCGCCATTACTCCCTGTTT pLKO.1 532 CDS 100% 4.950 3.960 N PIAS1 n/a
3 TRCN0000004144 CCACATCACCACTAAATAATA pLKO.1 1675 CDS 100% 15.000 10.500 N PIAS1 n/a
4 TRCN0000231897 ACTATTCCATGGCAGTATATC pLKO_005 1048 CDS 100% 13.200 9.240 N PIAS1 n/a
5 TRCN0000004147 CATGGCAGTATATCTTGTAAA pLKO.1 1055 CDS 100% 13.200 9.240 N PIAS1 n/a
6 TRCN0000231899 CGACTTACAAGGATTAGATTT pLKO_005 1832 CDS 100% 13.200 9.240 N PIAS1 n/a
7 TRCN0000231898 CCGGATCATTCTAGAGCTTTA pLKO_005 1131 CDS 100% 10.800 7.560 N PIAS1 n/a
8 TRCN0000010853 CCCATGCCTTACGACTTACAA pLKO.1 1821 CDS 100% 5.625 3.938 N PIAS1 n/a
9 TRCN0000004145 GATCGAATGAACTTGGCAGAA pLKO.1 2208 3UTR 100% 4.050 2.835 N PIAS1 n/a
10 TRCN0000231900 GGCAGAAAGAAGAGAACTTTG pLKO_005 2222 3UTR 100% 10.800 6.480 N PIAS1 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 222 5UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 222 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022691.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01953 pDONR223 100% 98.6% 98.6% None 0_1ins27 n/a
2 ccsbBroad304_01953 pLX_304 0% 98.6% 98.6% V5 0_1ins27 n/a
3 TRCN0000466169 ATCAAATCTGACTGTCACGGCAGC pLX_317 19.1% 98.6% 98.6% V5 0_1ins27 n/a
Download CSV