Transcript: Human XM_017022693.2

PREDICTED: Homo sapiens synaptosome associated protein 23 (SNAP23), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SNAP23 (8773)
Length:
1586
CDS:
87..728

Additional Resources:

NCBI RefSeq record:
XM_017022693.2
NBCI Gene record:
SNAP23 (8773)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022693.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000145326 GAACAACTAAACCGCATAGAA pLKO.1 234 CDS 100% 5.625 7.875 N SNAP23 n/a
2 TRCN0000142667 CGCATAACTAATGATGCCAGA pLKO.1 510 CDS 100% 2.160 3.024 N SNAP23 n/a
3 TRCN0000141093 CCTGAACATAGGCAATGAGAT pLKO.1 596 CDS 100% 4.950 3.960 N SNAP23 n/a
4 TRCN0000219097 CAGTATCCTGGGAAATCTAAA pLKO_005 566 CDS 100% 13.200 9.240 N SNAP23 n/a
5 TRCN0000229795 GAGTCTGGCAAGGCTTATAAG pLKO_005 366 CDS 100% 13.200 9.240 N SNAP23 n/a
6 TRCN0000218039 GTGGATACATTAAACGCATAA pLKO_005 496 CDS 100% 10.800 7.560 N SNAP23 n/a
7 TRCN0000145577 CACCTTGCAATGTAGTATCTA pLKO.1 415 CDS 100% 5.625 3.938 N SNAP23 n/a
8 TRCN0000143958 CTGAACATAGGCAATGAGATT pLKO.1 597 CDS 100% 4.950 3.465 N SNAP23 n/a
9 TRCN0000144788 GCAAGGCTTATAAGACAACAT pLKO.1 373 CDS 100% 4.950 3.465 N SNAP23 n/a
10 TRCN0000144789 GCAATGAGATTGATGCTCAAA pLKO.1 607 CDS 100% 4.950 3.465 N SNAP23 n/a
11 TRCN0000141271 CTCACCAGATTACTGATGAGT pLKO.1 124 CDS 100% 3.000 2.100 N SNAP23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022693.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02013 pDONR223 100% 91.7% 84.9% None (many diffs) n/a
2 ccsbBroad304_02013 pLX_304 0% 91.7% 84.9% V5 (many diffs) n/a
3 TRCN0000470641 TGTAATGATATTTGACCGAATGTC pLX_317 55.8% 91.7% 84.9% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV