Transcript: Human XM_017022698.1

PREDICTED: Homo sapiens HECT and RLD domain containing E3 ubiquitin protein ligase 2 (HERC2), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HERC2 (8924)
Length:
8577
CDS:
184..7854

Additional Resources:

NCBI RefSeq record:
XM_017022698.1
NBCI Gene record:
HERC2 (8924)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022698.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007382 CGGACTCTACACAAGATTATT pLKO.1 7820 CDS 100% 15.000 12.000 N HERC2 n/a
2 TRCN0000007380 CCAGAGGATATTTAAACCAAA pLKO.1 8362 3UTR 100% 4.950 3.465 N HERC2 n/a
3 TRCN0000007383 CCTATGAAGATTGATTCTCTT pLKO.1 5911 CDS 100% 4.950 3.465 N HERC2 n/a
4 TRCN0000007384 GCAAGTAATTCTAAGCCAAAT pLKO.1 3457 CDS 100% 10.800 6.480 N HERC2 n/a
5 TRCN0000153856 CCAGCAGTTGAAGCTATACAT pLKO.1 303 CDS 100% 5.625 2.813 Y HERC2P3 n/a
6 TRCN0000152439 CGTGGCCTTTAATGTGAACAA pLKO.1 144 5UTR 100% 4.950 2.475 Y HERC2P3 n/a
7 TRCN0000118374 GCTGTATATGTGAGAGAGAAT pLKO.1 1039 CDS 100% 4.950 2.475 Y HERC2P2 n/a
8 TRCN0000118442 CCAGGCATACATTTGGCAGAA pLKO.1 1577 CDS 100% 4.050 2.025 Y HERC2P9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022698.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10386 pDONR223 100% 13.1% 11.8% None (many diffs) n/a
2 ccsbBroad304_10386 pLX_304 0% 13.1% 11.8% V5 (many diffs) n/a
3 TRCN0000475511 ATATGGTCGGTGCGGGTATATATA pLX_317 35.5% 13.1% 11.8% V5 (many diffs) n/a
Download CSV