Transcript: Human XM_017023136.2

PREDICTED: Homo sapiens glycine cleavage system protein H (GCSH), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GCSH (2653)
Length:
1323
CDS:
22..561

Additional Resources:

NCBI RefSeq record:
XM_017023136.2
NBCI Gene record:
GCSH (2653)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023136.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083393 CGTTGGGAGATGTTGTTTATT pLKO.1 254 CDS 100% 15.000 9.000 N GCSH n/a
2 TRCN0000431141 AGGAGAAGTAACTGAAATTAA pLKO_005 372 CDS 100% 15.000 7.500 Y GCSH n/a
3 TRCN0000083395 GTGAACTCTATTCTCCTTTAT pLKO.1 350 CDS 100% 13.200 6.600 Y GCSH n/a
4 TRCN0000414026 GTGGATAGAAGACTTAGAATA pLKO_005 627 3UTR 100% 13.200 6.600 Y GCSH n/a
5 TRCN0000428788 TGAGGAACACCACTATCTTAA pLKO_005 996 3UTR 100% 13.200 6.600 Y GCSH n/a
6 TRCN0000420734 TTTGGGATGAAATACTTAATG pLKO_005 917 3UTR 100% 13.200 6.600 Y GCSH n/a
7 TRCN0000431977 GAACAGTGGGAATCAGCAATT pLKO_005 221 CDS 100% 10.800 5.400 Y GCSH n/a
8 TRCN0000083397 CAGGACTTGTAAACAAATCTT pLKO.1 413 CDS 100% 5.625 2.813 Y GCSH n/a
9 TRCN0000083396 GATGAACTTATGAGTGAAGAA pLKO.1 505 CDS 100% 4.950 2.475 Y GCSH n/a
10 TRCN0000083394 GTGCGTAAATTCACAGAGAAA pLKO.1 169 CDS 100% 4.950 2.475 Y GCSH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023136.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06268 pDONR223 100% 96.4% 96% None 62C>T;424_441del n/a
2 ccsbBroad304_06268 pLX_304 0% 96.4% 96% V5 62C>T;424_441del n/a
3 TRCN0000471706 TCATGCTTAGTCCCCTTTCGGGCA pLX_317 64.1% 96.4% 96% V5 62C>T;424_441del n/a
4 ccsbBroadEn_10843 pDONR223 100% 54.3% 54.1% None 62C>T;294_537delinsC n/a
5 ccsbBroad304_10843 pLX_304 0% 54.3% 54.1% V5 62C>T;294_537delinsC n/a
6 TRCN0000466691 TCCAACGCAGCACACTCACTGTGG pLX_317 82.4% 54.3% 54.1% V5 62C>T;294_537delinsC n/a
Download CSV