Transcript: Human XM_017023207.1

PREDICTED: Homo sapiens C-type lectin domain family 18 member A (CLEC18A), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CLEC18A (348174)
Length:
3870
CDS:
258..1448

Additional Resources:

NCBI RefSeq record:
XM_017023207.1
NBCI Gene record:
CLEC18A (348174)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023207.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372921 ACCGTTACATCTGCCAGTTTG pLKO_005 1300 CDS 100% 10.800 5.400 Y CLEC18C n/a
2 TRCN0000372982 AGACCACCAACGAGGTGATTG pLKO_005 1078 CDS 100% 10.800 5.400 Y CLEC18C n/a
3 TRCN0000157309 CTTCAGAGGCAGACACCTATT pLKO.1 958 CDS 100% 10.800 5.400 Y CLEC18B n/a
4 TRCN0000164315 CTTCAGAGGCAGACACCTATT pLKO.1 958 CDS 100% 10.800 5.400 Y CLEC18C n/a
5 TRCN0000155154 GAACAGGAAGGAGAGTTTCTT pLKO.1 386 CDS 100% 5.625 2.813 Y CLEC18B n/a
6 TRCN0000161377 GAACAGGAAGGAGAGTTTCTT pLKO.1 386 CDS 100% 5.625 2.813 Y CLEC18A n/a
7 TRCN0000156449 CCTGAACAGGAAGGAGAGTTT pLKO.1 383 CDS 100% 4.950 2.475 Y CLEC18B n/a
8 TRCN0000162824 CGAGGTGATTGACAGTGACTT pLKO.1 1088 CDS 100% 4.950 2.475 Y CLEC18A n/a
9 TRCN0000162317 CTATTACAGAGCCAGGATGAA pLKO.1 974 CDS 100% 4.950 2.475 Y CLEC18A n/a
10 TRCN0000162851 CAGAGCCAGGATGAAATGTCA pLKO.1 980 CDS 100% 3.000 1.500 Y CLEC18C n/a
11 TRCN0000160801 CAGGATGAAATGTCAGAGGAA pLKO.1 986 CDS 100% 2.640 1.320 Y CLEC18C n/a
12 TRCN0000164146 CCAGGATGAAATGTCAGAGGA pLKO.1 985 CDS 100% 2.640 1.320 Y CLEC18A n/a
13 TRCN0000156731 GAAACCGTTACATCTGCCAGT pLKO.1 1297 CDS 100% 2.160 1.080 Y CLEC18B n/a
14 TRCN0000163524 GAAACCGTTACATCTGCCAGT pLKO.1 1297 CDS 100% 2.160 1.080 Y CLEC18A n/a
15 TRCN0000157176 GAAGGAGAGTTTCTTGCTCCT pLKO.1 392 CDS 100% 0.216 0.108 Y CLEC18B n/a
16 TRCN0000163539 GAAGGAGAGTTTCTTGCTCCT pLKO.1 392 CDS 100% 0.216 0.108 Y CLEC18A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023207.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10057 pDONR223 100% 75.4% 72.8% None (many diffs) n/a
2 ccsbBroad304_10057 pLX_304 0% 75.4% 72.8% V5 (many diffs) n/a
3 TRCN0000472938 GACTAAGCATTGCTCAGGGTACCC pLX_317 22.1% 75.4% 72.8% V5 (many diffs) n/a
4 ccsbBroadEn_13508 pDONR223 100% 45.8% 44.3% None (many diffs) n/a
5 ccsbBroad304_13508 pLX_304 0% 45.8% 44.3% V5 (many diffs) n/a
6 TRCN0000471241 ATCATCACAACCTTTCGCCCATAC pLX_317 48.2% 45.8% 44.3% V5 (many diffs) n/a
Download CSV