Transcript: Human XM_017023376.1

PREDICTED: Homo sapiens lysophosphatidylcholine acyltransferase 2 (LPCAT2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LPCAT2 (54947)
Length:
5358
CDS:
324..1790

Additional Resources:

NCBI RefSeq record:
XM_017023376.1
NBCI Gene record:
LPCAT2 (54947)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023376.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413077 GTCTTATTGGTTGCGTTAATT pLKO_005 363 CDS 100% 15.000 21.000 N LPCAT2 n/a
2 TRCN0000055781 CCTTCTATGGTATCTCGAAAT pLKO.1 636 CDS 100% 10.800 15.120 N LPCAT2 n/a
3 TRCN0000055780 CCAGTTCAAGTACCAAATGAT pLKO.1 1014 CDS 100% 5.625 7.875 N LPCAT2 n/a
4 TRCN0000422857 AGCTCTGGGAATACCAGTAAC pLKO_005 1091 CDS 100% 10.800 8.640 N LPCAT2 n/a
5 TRCN0000247199 GATCATCCAGGTGGCATTTAA pLKO_005 1448 CDS 100% 15.000 10.500 N Lpcat2 n/a
6 TRCN0000425733 GCCAATAAAGTCCGGAATTTA pLKO_005 1062 CDS 100% 15.000 10.500 N LPCAT2 n/a
7 TRCN0000055782 GCCTTAAAGCATCCAGAATAT pLKO.1 1623 CDS 100% 13.200 9.240 N LPCAT2 n/a
8 TRCN0000433870 GGATGGTGTTCGTAAGCATTT pLKO_005 1226 CDS 100% 10.800 7.560 N LPCAT2 n/a
9 TRCN0000055779 CCTCCTCAGATACCCAAACAA pLKO.1 893 CDS 100% 5.625 3.938 N LPCAT2 n/a
10 TRCN0000055778 GCACTCTTTGACAGGAACCAT pLKO.1 1356 CDS 100% 3.000 2.100 N LPCAT2 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2632 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2632 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023376.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03492 pDONR223 100% 89.5% 89.5% None 0_1ins169;2delT n/a
2 ccsbBroad304_03492 pLX_304 0% 89.5% 89.5% V5 0_1ins169;2delT n/a
3 TRCN0000466414 ACACGCGACTGCCCACTGGCATTA pLX_317 10.4% 89.5% 89.5% V5 0_1ins169;2delT n/a
Download CSV