Transcript: Human XM_017023589.2

PREDICTED: Homo sapiens NDRG family member 4 (NDRG4), transcript variant X20, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NDRG4 (65009)
Length:
3319
CDS:
122..1276

Additional Resources:

NCBI RefSeq record:
XM_017023589.2
NBCI Gene record:
NDRG4 (65009)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023589.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134583 GACTGAAGCCTTCAAATACTT pLKO.1 1081 CDS 100% 5.625 3.938 N NDRG4 n/a
2 TRCN0000137674 GAAGCTGACTGAAGCCTTCAA pLKO.1 1075 CDS 100% 4.950 3.465 N NDRG4 n/a
3 TRCN0000138040 GCAGCTCTTCTGGAACATGTA pLKO.1 850 CDS 100% 4.950 3.465 N NDRG4 n/a
4 TRCN0000137216 GCTCTTCTGGAACATGTACAA pLKO.1 853 CDS 100% 4.950 3.465 N NDRG4 n/a
5 TRCN0000138797 GCCTCAACCACAAACTATGCT pLKO.1 375 CDS 100% 3.000 2.100 N NDRG4 n/a
6 TRCN0000137575 CCTAACTAGCACTTTACCCGA pLKO.1 724 CDS 100% 0.660 0.462 N NDRG4 n/a
7 TRCN0000138639 CATCCTCACCTACCATGATGT pLKO.1 352 CDS 100% 4.950 2.970 N NDRG4 n/a
8 TRCN0000133825 CAAACTATGCTTCAACACCTT pLKO.1 385 CDS 100% 2.640 1.584 N NDRG4 n/a
9 TRCN0000137231 GCCTTCAAATACTTCCTGCAA pLKO.1 1088 CDS 100% 2.640 1.584 N NDRG4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023589.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12508 pDONR223 100% 87.8% 86.4% None (many diffs) n/a
2 ccsbBroad304_12508 pLX_304 0% 87.8% 86.4% V5 (many diffs) n/a
3 TRCN0000471852 TGATTCATGTCCCCATCGGCCGGG pLX_317 50.4% 87.8% 86.4% V5 (many diffs) n/a
Download CSV