Transcript: Human XM_017023653.2

PREDICTED: Homo sapiens ubiquitin specific peptidase 7 (USP7), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USP7 (7874)
Length:
4936
CDS:
5..3298

Additional Resources:

NCBI RefSeq record:
XM_017023653.2
NBCI Gene record:
USP7 (7874)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023653.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010845 CGTGGTGTCAAGGTGTACTAA pLKO.1 1405 CDS 100% 5.625 4.500 N USP7 n/a
2 TRCN0000349562 CGTGGTGTCAAGGTGTACTAA pLKO_005 1405 CDS 100% 5.625 4.500 N USP7 n/a
3 TRCN0000004057 CCAGCTAAGTATCAAAGGAAA pLKO.1 1006 CDS 100% 4.950 3.960 N USP7 n/a
4 TRCN0000318578 CCAGCTAAGTATCAAAGGAAA pLKO_005 1006 CDS 100% 4.950 3.960 N USP7 n/a
5 TRCN0000004060 GTGTCCTATATCCAGTGTAAA pLKO.1 941 CDS 100% 13.200 9.240 N USP7 n/a
6 TRCN0000004058 CCTGGATTTGTGGTTACGTTA pLKO.1 2375 CDS 100% 4.950 3.465 N USP7 n/a
7 TRCN0000318521 CCTGGATTTGTGGTTACGTTA pLKO_005 2375 CDS 100% 4.950 3.465 N USP7 n/a
8 TRCN0000051941 GCTTGAATTACTGTGGGCATA pLKO.1 2049 CDS 100% 4.050 2.835 N LOC345576 n/a
9 TRCN0000004059 TGTATCTATTGACTGCCCTTT pLKO.1 3867 3UTR 100% 4.050 2.835 N USP7 n/a
10 TRCN0000349627 TGTATCTATTGACTGCCCTTT pLKO_005 3867 3UTR 100% 4.050 2.835 N USP7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023653.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488632 CAAAGCCTTACGGATTTATGACCC pLX_317 9.7% 95.4% 93.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488786 AGGTGGATCCGCTATATAACTTTG pLX_317 11.6% 95.4% 93.1% V5 (many diffs) n/a
Download CSV