Transcript: Human XM_017023669.1

PREDICTED: Homo sapiens WD repeat domain 59 (WDR59), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDR59 (79726)
Length:
3375
CDS:
676..2736

Additional Resources:

NCBI RefSeq record:
XM_017023669.1
NBCI Gene record:
WDR59 (79726)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023669.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157708 CCCTGTAAGGTGTTAGCCTTA pLKO.1 3059 3UTR 100% 0.405 0.567 N WDR59 n/a
2 TRCN0000152608 GCCTCGGAAATACCTCAATAT pLKO.1 503 5UTR 100% 13.200 10.560 N WDR59 n/a
3 TRCN0000153504 CGAGCTGAAGTGTTGAAGTTT pLKO.1 2446 CDS 100% 5.625 4.500 N WDR59 n/a
4 TRCN0000157812 CCGGAATGTCAATGTGGAGAT pLKO.1 960 CDS 100% 4.050 3.240 N WDR59 n/a
5 TRCN0000277692 CTTTGTGCAAATGACATATTA pLKO_005 721 CDS 100% 15.000 10.500 N WDR59 n/a
6 TRCN0000150950 GCTTTAGAAGCTGGTACATTT pLKO.1 3183 3UTR 100% 13.200 9.240 N WDR59 n/a
7 TRCN0000277633 ACCTACAGAAGTTGGGTATTG pLKO_005 2737 CDS 100% 10.800 7.560 N WDR59 n/a
8 TRCN0000277691 ATGACGGCGATGTGCGGATAT pLKO_005 337 5UTR 100% 10.800 7.560 N WDR59 n/a
9 TRCN0000277690 GAGCAGGTTACCTGGTATATT pLKO_005 1391 CDS 100% 15.000 9.000 N WDR59 n/a
10 TRCN0000182517 CCTCACAAAGGGATCGAGTTT pLKO.1 2485 CDS 100% 4.950 6.930 N Wdr59 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023669.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12603 pDONR223 100% 26.5% 25.3% None 0_1ins841;44_45ins80;792_2058delinsG n/a
2 ccsbBroad304_12603 pLX_304 0% 26.5% 25.3% V5 0_1ins841;44_45ins80;792_2058delinsG n/a
Download CSV