Transcript: Human XM_017023740.1

PREDICTED: Homo sapiens neuropilin and tolloid like 2 (NETO2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NETO2 (81831)
Length:
3289
CDS:
536..1705

Additional Resources:

NCBI RefSeq record:
XM_017023740.1
NBCI Gene record:
NETO2 (81831)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023740.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118476 CCTCCTCATTATGAACTGTTT pLKO.1 1310 CDS 100% 4.950 3.960 N NETO2 n/a
2 TRCN0000300262 CCTCCTCATTATGAACTGTTT pLKO_005 1310 CDS 100% 4.950 3.960 N NETO2 n/a
3 TRCN0000118474 CGCCAAATTATCCTGACTCAT pLKO.1 303 5UTR 100% 4.950 3.960 N NETO2 n/a
4 TRCN0000300261 CGCCAAATTATCCTGACTCAT pLKO_005 303 5UTR 100% 4.950 3.960 N NETO2 n/a
5 TRCN0000118472 GCTCTAAATCACTACACAAAT pLKO.1 3085 3UTR 100% 13.200 9.240 N NETO2 n/a
6 TRCN0000300264 GCTCTAAATCACTACACAAAT pLKO_005 3085 3UTR 100% 13.200 9.240 N NETO2 n/a
7 TRCN0000118473 CCATCATTTGAGTGTCGGTTT pLKO.1 413 5UTR 100% 4.050 2.835 N NETO2 n/a
8 TRCN0000300309 CCATCATTTGAGTGTCGGTTT pLKO_005 413 5UTR 100% 4.050 2.835 N NETO2 n/a
9 TRCN0000086947 GCAGTCTATGATGGAAGCAGT pLKO.1 845 CDS 100% 2.640 1.848 N Neto2 n/a
10 TRCN0000118475 GCCAATGATGTAATGCTTAAA pLKO.1 905 CDS 100% 13.200 7.920 N NETO2 n/a
11 TRCN0000300263 GCCAATGATGTAATGCTTAAA pLKO_005 905 CDS 100% 13.200 7.920 N NETO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023740.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12728 pDONR223 100% 38% 38% None 1_723del n/a
2 ccsbBroad304_12728 pLX_304 0% 38% 38% V5 1_723del n/a
3 TRCN0000469206 TTTGATATTGTAGGTATGTGATCT pLX_317 98.7% 38% 38% V5 1_723del n/a
Download CSV