Transcript: Human XM_017023756.1

PREDICTED: Homo sapiens lon peptidase 2, peroxisomal (LONP2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LONP2 (83752)
Length:
2027
CDS:
88..1905

Additional Resources:

NCBI RefSeq record:
XM_017023756.1
NBCI Gene record:
LONP2 (83752)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023756.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423387 CCAGATTGTACAGGTCTTAAA pLKO_005 411 CDS 100% 13.200 18.480 N LONP2 n/a
2 TRCN0000415696 ATGCCAGAGCAGGCCCATAAA pLKO_005 799 CDS 100% 13.200 9.240 N LONP2 n/a
3 TRCN0000417010 CATAACTTCACAGATCATTAT pLKO_005 1360 CDS 100% 13.200 9.240 N LONP2 n/a
4 TRCN0000046832 CCACTGCTTGTCAGACAAATT pLKO.1 601 CDS 100% 13.200 9.240 N LONP2 n/a
5 TRCN0000046830 CCCACTACACTCTGTTGATTA pLKO.1 374 CDS 100% 13.200 9.240 N LONP2 n/a
6 TRCN0000046829 CCTCAGTCAATGCCAGAATAT pLKO.1 856 CDS 100% 13.200 9.240 N LONP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023756.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09113 pDONR223 100% 70.7% 70.6% None (many diffs) n/a
2 ccsbBroad304_09113 pLX_304 0% 70.7% 70.6% V5 (many diffs) n/a
3 TRCN0000476793 CATAAACACCTAATGTCAAGTTCT pLX_317 14.1% 70.7% 70.6% V5 (many diffs) n/a
Download CSV