Transcript: Human XM_017023890.1

PREDICTED: Homo sapiens zinc finger protein 276 (ZNF276), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF276 (92822)
Length:
3525
CDS:
665..1867

Additional Resources:

NCBI RefSeq record:
XM_017023890.1
NBCI Gene record:
ZNF276 (92822)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023890.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017765 CCACCATCTACAAGTGTCCTT pLKO.1 1314 CDS 100% 2.640 2.112 N ZNF276 n/a
2 TRCN0000244379 CTGGACATCTCTGCCTATTAT pLKO_005 3205 3UTR 100% 15.000 10.500 N ZNF276 n/a
3 TRCN0000244277 ACACAGAGGTGCGGAACTATA pLKO_005 1491 CDS 100% 13.200 9.240 N ZNF276 n/a
4 TRCN0000244380 CTCTGGTAAGAAGAGTGAAAG pLKO_005 1195 CDS 100% 10.800 7.560 N ZNF276 n/a
5 TRCN0000244378 TCAAGTGGCCATGGGACAAAG pLKO_005 830 CDS 100% 10.800 7.560 N ZNF276 n/a
6 TRCN0000280643 CCACGACTACACCATGGATAC pLKO_005 765 CDS 100% 6.000 4.200 N ZNF276 n/a
7 TRCN0000017764 CCATCTTCAACCTCGGATGAT pLKO.1 1084 CDS 100% 4.950 3.465 N ZNF276 n/a
8 TRCN0000017767 CCTTTGAGCCTTACCCAGAAA pLKO.1 1167 CDS 100% 4.950 3.465 N ZNF276 n/a
9 TRCN0000017763 CGGCATGAAGAAGCACATCAA pLKO.1 1369 CDS 100% 4.950 3.465 N ZNF276 n/a
10 TRCN0000017766 CCAAGAAGTCTGAAGAACCAA pLKO.1 1224 CDS 100% 3.000 2.100 N ZNF276 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023890.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12982 pDONR223 100% 88.1% 66% None 1_113del;177T>C;441_442ins32 n/a
2 ccsbBroad304_12982 pLX_304 0% 88.1% 66% V5 1_113del;177T>C;441_442ins32 n/a
3 TRCN0000491426 GCCGACGTGCCGGACTAACATATT pLX_317 28.2% 88.1% 66% V5 1_113del;177T>C;441_442ins32 n/a
4 ccsbBroadEn_09351 pDONR223 100% 74% 52.4% None (many diffs) n/a
5 ccsbBroad304_09351 pLX_304 0% 74% 52.4% V5 (many diffs) n/a
6 TRCN0000470299 CTAGGAGCTGCGTTGACTGCGTTT pLX_317 23.8% 74% 52.4% V5 (many diffs) n/a
Download CSV