Transcript: Human XM_017024150.1

PREDICTED: Homo sapiens kinesin family member 19 (KIF19), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIF19 (124602)
Length:
3685
CDS:
139..3177

Additional Resources:

NCBI RefSeq record:
XM_017024150.1
NBCI Gene record:
KIF19 (124602)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024150.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139013 CATCGCCCATAAAGTGGATGA pLKO.1 234 CDS 100% 4.050 5.670 N KIF19 n/a
2 TRCN0000141329 CATCTATGTTCAGACCCTCAA pLKO.1 504 CDS 100% 4.050 5.670 N KIF19 n/a
3 TRCN0000139279 CGACTCAAGCGCAAGATTGAT pLKO.1 1306 CDS 100% 5.625 3.938 N KIF19 n/a
4 TRCN0000144320 GAACATTAAGACTAGGGTGAA pLKO.1 1209 CDS 100% 4.050 2.835 N KIF19 n/a
5 TRCN0000139247 CATGGAGTATGAGGTCTCCAT pLKO.1 561 CDS 100% 0.264 0.185 N KIF19 n/a
6 TRCN0000139804 CACCATCAATGCCAAGGAGAT pLKO.1 702 CDS 100% 4.050 2.430 N KIF19 n/a
7 TRCN0000139534 CAATGCCACTGTCTTTGCCTA pLKO.1 426 CDS 100% 2.640 1.320 Y KIF19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024150.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13108 pDONR223 100% 11.7% 3.5% None (many diffs) n/a
2 ccsbBroad304_13108 pLX_304 0% 11.7% 3.5% V5 (many diffs) n/a
3 TRCN0000491884 AGTCAAACCGGAGGCCTCGTATCA pLX_317 100% 11.7% 3.5% V5 (many diffs) n/a
Download CSV