Transcript: Human XM_017024191.2

PREDICTED: Homo sapiens solute carrier family 5 member 10 (SLC5A10), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC5A10 (125206)
Length:
2231
CDS:
28..1977

Additional Resources:

NCBI RefSeq record:
XM_017024191.2
NBCI Gene record:
SLC5A10 (125206)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024191.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043638 CGTCACCTTACCTGAGTACAT pLKO.1 378 CDS 100% 4.950 6.930 N SLC5A10 n/a
2 TRCN0000043642 CTGTCTGTCTTCACCAAGATA pLKO.1 457 CDS 100% 5.625 3.938 N SLC5A10 n/a
3 TRCN0000043639 CGGGCAACTCTTCATCTACAT pLKO.1 1494 CDS 100% 4.950 3.465 N SLC5A10 n/a
4 TRCN0000043641 GCTCATGTCTATGAGGAGAGA pLKO.1 1012 CDS 100% 0.264 0.185 N SLC5A10 n/a
5 TRCN0000043640 CATCCTCCTCATGTGTGTCAA pLKO.1 1929 CDS 100% 4.950 2.970 N SLC5A10 n/a
6 TRCN0000252451 TCCTCATGTGTGTCAACATTT pLKO_005 1934 CDS 100% 13.200 9.240 N Slc5a10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024191.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489178 AGCGATGGTCATCATCGAACCAGT pLX_317 20.8% 94.2% 94.2% V5 (not translated due to prior stop codon) 1289_1399del n/a
2 ccsbBroadEn_13112 pDONR223 100% 87.2% 87.2% None 1_168del;558_638del n/a
3 ccsbBroad304_13112 pLX_304 0% 87.2% 87.2% V5 1_168del;558_638del n/a
Download CSV