Transcript: Human XM_017024507.1

PREDICTED: Homo sapiens solute carrier family 26 member 11 (SLC26A11), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC26A11 (284129)
Length:
2962
CDS:
284..2176

Additional Resources:

NCBI RefSeq record:
XM_017024507.1
NBCI Gene record:
SLC26A11 (284129)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024507.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428482 ATGACGTCAAGTCTCTATTTA pLKO_005 2646 3UTR 100% 15.000 21.000 N SLC26A11 n/a
2 TRCN0000416690 AGGGTGTTCCGGAAGGTTCTT pLKO_005 2207 3UTR 100% 4.950 6.930 N SLC26A11 n/a
3 TRCN0000436832 CCATCGGTCTCACCAACATGT pLKO_005 1386 CDS 100% 4.950 6.930 N SLC26A11 n/a
4 TRCN0000426425 GGGTTCCAGTACTTCTCTACC pLKO_005 2051 CDS 100% 4.050 5.670 N SLC26A11 n/a
5 TRCN0000417722 CCCGTCATTAAAGGCTTCACC pLKO_005 809 CDS 100% 2.640 3.696 N SLC26A11 n/a
6 TRCN0000418726 TTGCGTACTCCTTCGAGGTGA pLKO_005 1128 CDS 100% 2.640 3.696 N SLC26A11 n/a
7 TRCN0000429414 GCCCTGCTCAAGGCATAATGG pLKO_005 2159 CDS 100% 1.650 2.310 N SLC26A11 n/a
8 TRCN0000044898 CCTTCGCATCTCAGAATAATT pLKO.1 1335 CDS 100% 15.000 12.000 N SLC26A11 n/a
9 TRCN0000044901 GCAGTGGCTGAAGATGGATTT pLKO.1 418 CDS 100% 10.800 7.560 N SLC26A11 n/a
10 TRCN0000429128 TGGAGAGAGCCTTCTAGAATG pLKO_005 2431 3UTR 100% 10.800 7.560 N SLC26A11 n/a
11 TRCN0000425173 ACCACACCTTCCTCAGGATTG pLKO_005 918 CDS 100% 6.000 4.200 N SLC26A11 n/a
12 TRCN0000430228 ATACCAGCCTTTCATCCTAAC pLKO_005 1153 CDS 100% 6.000 4.200 N SLC26A11 n/a
13 TRCN0000044900 CCTGACCTCACTGTTCTACTA pLKO.1 1537 CDS 100% 4.950 3.465 N SLC26A11 n/a
14 TRCN0000044902 GCCCTACAACATCAGAGAAGA pLKO.1 2116 CDS 100% 4.950 3.465 N SLC26A11 n/a
15 TRCN0000421972 CCATGTCTGCAGCATCGACTA pLKO_005 1912 CDS 100% 4.050 2.835 N SLC26A11 n/a
16 TRCN0000044899 CCTGCTGGACTTCATTTCCTA pLKO.1 787 CDS 100% 3.000 2.100 N SLC26A11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024507.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13519 pDONR223 100% 93.4% 93.3% None 1_51del;427_498del;1819G>A n/a
2 ccsbBroad304_13519 pLX_304 0% 93.4% 93.3% V5 1_51del;427_498del;1819G>A n/a
3 TRCN0000478298 ACTATCTATAGAGAGGTACGGGAC pLX_317 18.1% 93.4% 93.3% V5 1_51del;427_498del;1819G>A n/a
Download CSV