Transcript: Human XM_017024621.1

PREDICTED: Homo sapiens yippee like 2 (YPEL2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
YPEL2 (388403)
Length:
5248
CDS:
347..706

Additional Resources:

NCBI RefSeq record:
XM_017024621.1
NBCI Gene record:
YPEL2 (388403)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024621.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000442655 ACGCCATTCAACCGAACATTC pLKO_005 742 3UTR 100% 10.800 15.120 N YPEL2 n/a
2 TRCN0000116237 CCTGATAACTTAGGCTTGAAA pLKO.1 1168 3UTR 100% 5.625 7.875 N YPEL2 n/a
3 TRCN0000424276 AGGACGAGCATACCTCTTTAA pLKO_005 481 CDS 100% 13.200 9.240 N YPEL2 n/a
4 TRCN0000454958 GAACTAATTTCCAAGTCATTC pLKO_005 449 CDS 100% 10.800 7.560 N YPEL2 n/a
5 TRCN0000116240 TGGCCAATCATGATGAACTAA pLKO.1 435 CDS 100% 5.625 3.938 N YPEL2 n/a
6 TRCN0000116239 CATCATTGAACTAGCACACAT pLKO.1 661 CDS 100% 4.950 3.465 N YPEL2 n/a
7 TRCN0000426625 GCACACATGATCAAGGACAAT pLKO_005 674 CDS 100% 4.950 3.465 N YPEL2 n/a
8 TRCN0000433042 AGTCATTCCAAGGAAGTCAAG pLKO_005 462 CDS 100% 4.050 2.835 N YPEL2 n/a
9 TRCN0000116241 GTGTTGCTAACAGGACTGCAT pLKO.1 542 CDS 100% 2.640 1.848 N YPEL2 n/a
10 TRCN0000116238 CCTCTTTAACTCAGTAGTTAA pLKO.1 493 CDS 100% 1.320 0.924 N YPEL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024621.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05581 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05581 pLX_304 0% 100% 100% V5 n/a
3 ccsbBroadEn_08123 pDONR223 100% 80.6% 95.7% None (many diffs) n/a
4 ccsbBroad304_08123 pLX_304 0% 80.6% 95.7% V5 (many diffs) n/a
5 TRCN0000472132 TTCAACAATTGAGCCTCATAACTA pLX_317 100% 80.6% 95.7% V5 (many diffs) n/a
Download CSV