Transcript: Human XM_017024685.2

PREDICTED: Homo sapiens myosin ID (MYO1D), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MYO1D (4642)
Length:
4642
CDS:
301..3168

Additional Resources:

NCBI RefSeq record:
XM_017024685.2
NBCI Gene record:
MYO1D (4642)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024685.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000292526 TCCGTAAGGTAAATCGATTTA pLKO_005 2888 CDS 100% 13.200 18.480 N MYO1D n/a
2 TRCN0000183101 CCCTTACAAGTTGTTGAACAT pLKO.1 450 CDS 100% 4.950 3.960 N MYO1D n/a
3 TRCN0000148706 CCTTGATGATGCTTGCATGAA pLKO.1 1665 CDS 100% 4.950 3.465 N MYO1D n/a
4 TRCN0000292449 CCTTGATGATGCTTGCATGAA pLKO_005 1665 CDS 100% 4.950 3.465 N MYO1D n/a
5 TRCN0000146639 CTTGTAGTGTTCCATACGAAA pLKO.1 3046 CDS 100% 4.950 3.465 N MYO1D n/a
6 TRCN0000292447 CTTGTAGTGTTCCATACGAAA pLKO_005 3046 CDS 100% 4.950 3.465 N MYO1D n/a
7 TRCN0000147315 GAACCCTTACAAGTTGTTGAA pLKO.1 447 CDS 100% 4.950 3.465 N MYO1D n/a
8 TRCN0000292523 GAACCCTTACAAGTTGTTGAA pLKO_005 447 CDS 100% 4.950 3.465 N MYO1D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024685.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10983 pDONR223 100% 45.4% 45.2% None 1296_1297insGTGGG;1301delA;1305_2865del n/a
2 ccsbBroad304_10983 pLX_304 0% 45.4% 45.2% V5 1296_1297insGTGGG;1301delA;1305_2865del n/a
3 TRCN0000480529 CACGTTTAACACTTGGCGGCCGTT pLX_317 30.2% 45.4% 45.2% V5 1296_1297insGTGGG;1301delA;1305_2865del n/a
Download CSV