Transcript: Human XM_017024847.2

PREDICTED: Homo sapiens testis expressed 2 (TEX2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TEX2 (55852)
Length:
9384
CDS:
124..1854

Additional Resources:

NCBI RefSeq record:
XM_017024847.2
NBCI Gene record:
TEX2 (55852)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024847.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242768 ACACCACCAAGTGCTCATAAA pLKO_005 1672 CDS 100% 13.200 18.480 N TEX2 n/a
2 TRCN0000242769 TCGGATACAGTGTCCTATAAG pLKO_005 811 CDS 100% 13.200 18.480 N TEX2 n/a
3 TRCN0000172383 CCCTCTGATACTCGTTCCTTT pLKO.1 934 CDS 100% 4.950 3.465 N TEX2 n/a
4 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 6850 3UTR 100% 4.950 2.475 Y ERAP2 n/a
5 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 6889 3UTR 100% 4.050 2.025 Y P3H4 n/a
6 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 6889 3UTR 100% 4.050 2.025 Y ORAI2 n/a
7 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 6889 3UTR 100% 4.050 2.025 Y P3H4 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 6851 3UTR 100% 13.200 6.600 Y LIAS n/a
9 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 7016 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024847.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.