Transcript: Human XM_017024877.1

PREDICTED: Homo sapiens DEAH-box helicase 33 (DHX33), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DHX33 (56919)
Length:
3134
CDS:
362..1201

Additional Resources:

NCBI RefSeq record:
XM_017024877.1
NBCI Gene record:
DHX33 (56919)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024877.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051458 GCTCAATATCTATCGGACCTT pLKO.1 763 CDS 100% 2.640 3.696 N DHX33 n/a
2 TRCN0000051462 CATTTCCTTTAGAACCCAAAT pLKO.1 573 CDS 100% 10.800 7.560 N DHX33 n/a
3 TRCN0000113058 CTAGCAATGAAAGTCCCAAAT pLKO.1 416 CDS 100% 10.800 7.560 N Dhx33 n/a
4 TRCN0000303729 TCTACACGGAGGACGAGTTTG pLKO_005 327 5UTR 100% 10.800 7.560 N DHX33 n/a
5 TRCN0000303662 TGACTTCCAGGAGCGTGAAAG pLKO_005 1317 3UTR 100% 10.800 6.480 N DHX33 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024877.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12312 pDONR223 100% 57.7% 57.7% None 0_1ins612 n/a
2 ccsbBroad304_12312 pLX_304 0% 57.7% 57.7% V5 0_1ins612 n/a
3 TRCN0000471365 TTAATTAGCCCCATTGTGCGTCGG pLX_317 33.3% 57.7% 57.7% V5 0_1ins612 n/a
Download CSV