Transcript: Human XM_017024920.2

PREDICTED: Homo sapiens retinoic acid receptor alpha (RARA), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RARA (5914)
Length:
2754
CDS:
306..1337

Additional Resources:

NCBI RefSeq record:
XM_017024920.2
NBCI Gene record:
RARA (5914)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024920.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020372 ACTACGAACAACAGCTCAGAA pLKO.1 573 CDS 100% 4.950 3.960 N RARA n/a
2 TRCN0000020369 CGCATCTACAAGCCTTGCTTT pLKO.1 195 5UTR 100% 4.950 3.960 N RARA n/a
3 TRCN0000285401 GGTATTAATTCTCGCTGGTTT pLKO_005 1827 3UTR 100% 4.950 3.960 N RARA n/a
4 TRCN0000275491 TCATTGAGAAGGTGCGCAAAG pLKO_005 508 CDS 100% 6.000 4.200 N RARA n/a
5 TRCN0000020370 CCCAAGATGCTAATGAAGATT pLKO.1 1071 CDS 100% 5.625 3.938 N RARA n/a
6 TRCN0000275552 CCCAAGATGCTAATGAAGATT pLKO_005 1071 CDS 100% 5.625 3.938 N RARA n/a
7 TRCN0000275553 CATTGACCTCTGGGACAAGTT pLKO_005 611 CDS 100% 4.950 3.465 N RARA n/a
8 TRCN0000020371 GTCTGTGAGAAACGACCGAAA pLKO.1 416 CDS 100% 4.050 2.835 N RARA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024920.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15561 pDONR223 0% 75% 75% None 0_1ins342 n/a
2 ccsbBroad304_15561 pLX_304 0% 75% 75% V5 0_1ins342 n/a
3 ccsbBroadEn_01375 pDONR223 100% 74.2% 74.2% None 0_1ins357 n/a
4 ccsbBroad304_01375 pLX_304 0% 74.2% 74.2% V5 0_1ins357 n/a
5 TRCN0000492202 TTTGGTGCCCCTTCGCAGCCGACC pLX_317 8.1% 74.2% 74.2% V5 0_1ins357 n/a
6 TRCN0000488701 CTCTTGACCGTCCGGCAAGACCCG pLX_317 25.8% 74.2% 74.2% V5 (not translated due to prior stop codon) 0_1ins357 n/a
7 TRCN0000489444 CCTTCAACCGGCCTCAACCATGCC pLX_317 26.2% 74.1% 74% V5 0_1ins357;1029_1030insG n/a
Download CSV