Transcript: Human XM_017024940.2

PREDICTED: Homo sapiens chromosome 17 open reading frame 75 (C17orf75), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C17orf75 (64149)
Length:
1347
CDS:
521..1174

Additional Resources:

NCBI RefSeq record:
XM_017024940.2
NBCI Gene record:
C17orf75 (64149)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145175 TGTTGTATGCCCAATCCAAA pXPR_003 GGG 82 13% 6 -0.0404 C17orf75 C17orf75 78077
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024940.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195492 CGATAGACTCTGAACGTAACC pLKO.1 402 5UTR 100% 4.050 3.240 N C17orf75 n/a
2 TRCN0000037674 GCCAGTCTTCAAGGACTTATT pLKO.1 731 CDS 100% 13.200 9.240 N C17orf75 n/a
3 TRCN0000196906 GTTACCGAGTTGGTTGTTATT pLKO.1 339 5UTR 100% 13.200 9.240 N C17orf75 n/a
4 TRCN0000196990 GAAGGCACCATGACTTCTTTG pLKO.1 755 CDS 100% 10.800 7.560 N C17orf75 n/a
5 TRCN0000037678 GCCATACAAGACACAAACAAT pLKO.1 959 CDS 100% 5.625 3.938 N C17orf75 n/a
6 TRCN0000194998 GATTTGAAACTCAATCCAGAT pLKO.1 1272 3UTR 100% 4.050 2.835 N C17orf75 n/a
7 TRCN0000037677 GCTTTGAGTTACACTCCTGTT pLKO.1 653 CDS 100% 4.050 2.835 N C17orf75 n/a
8 TRCN0000037676 GCTTCCTGAAACAGTAACGAT pLKO.1 385 5UTR 100% 3.000 2.100 N C17orf75 n/a
9 TRCN0000037675 GCAGCATAAGTCTGTGGTCAT pLKO.1 796 CDS 100% 4.050 2.430 N C17orf75 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024940.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03932 pDONR223 100% 54.7% 54.7% None 0_1ins537 n/a
2 TRCN0000478392 AACGCGCACTTCGTACGTGTCAAG pLX_317 28.5% 54.7% 54.7% V5 0_1ins537 n/a
3 ccsbBroadEn_15133 pDONR223 0% 54.7% 54.7% None 0_1ins537 n/a
4 ccsbBroad304_15133 pLX_304 0% 54.7% 54.7% V5 0_1ins537 n/a
5 TRCN0000471788 TTTAATATTGACAGGAGCATGTCT pLX_317 40.6% 54.7% 54.7% V5 0_1ins537 n/a
Download CSV