Transcript: Human XM_017024955.1

PREDICTED: Homo sapiens tektin 3 (TEKT3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TEKT3 (64518)
Length:
1525
CDS:
426..1400

Additional Resources:

NCBI RefSeq record:
XM_017024955.1
NBCI Gene record:
TEKT3 (64518)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024955.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116662 CGCCTGATTCAAGACAAATAT pLKO.1 303 5UTR 100% 15.000 21.000 N TEKT3 n/a
2 TRCN0000414599 CTGACGGAAGTTGATACTATT pLKO_005 585 CDS 100% 13.200 18.480 N TEKT3 n/a
3 TRCN0000116665 CCGACATAATTCGGAGAAACT pLKO.1 266 5UTR 100% 4.950 6.930 N TEKT3 n/a
4 TRCN0000116664 CGCTAAGCTAAGAGACGACAT pLKO.1 881 CDS 100% 4.050 5.670 N TEKT3 n/a
5 TRCN0000429067 GTAGCCCGAGAATGTCTATTT pLKO_005 507 CDS 100% 13.200 9.240 N TEKT3 n/a
6 TRCN0000116666 GCACTTACTGATGTGAAGAAA pLKO.1 444 CDS 100% 5.625 3.938 N TEKT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024955.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08858 pDONR223 100% 65.9% 65.9% None (many diffs) n/a
2 ccsbBroad304_08858 pLX_304 0% 65.9% 65.9% V5 (many diffs) n/a
3 TRCN0000472027 GAAAGTGATAGAGCAAGGCCTCGG pLX_317 33.2% 65.9% 65.9% V5 (many diffs) n/a
Download CSV