Transcript: Human XM_017025046.1

PREDICTED: Homo sapiens methyltransferase like 16 (METTL16), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
METTL16 (79066)
Length:
5509
CDS:
554..1588

Additional Resources:

NCBI RefSeq record:
XM_017025046.1
NBCI Gene record:
METTL16 (79066)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025046.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134846 CCAAAGTAACGTACACTGAAT pLKO.1 702 CDS 100% 4.950 6.930 N METTL16 n/a
2 TRCN0000137391 GCACCTACATACGTAACCAAA pLKO.1 1542 CDS 100% 4.950 6.930 N METTL16 n/a
3 TRCN0000138092 GCATAGTCGTTGTCACGACAT pLKO.1 912 CDS 100% 0.405 0.567 N METTL16 n/a
4 TRCN0000136881 CGCAACAGAAGTGGATGATAT pLKO.1 405 5UTR 100% 13.200 9.240 N METTL16 n/a
5 TRCN0000137017 CAACCTTGAATGGCTGGTATT pLKO.1 380 5UTR 100% 10.800 7.560 N METTL16 n/a
6 TRCN0000134192 CATCTGAAGTAGAGCTTGTTT pLKO.1 2342 3UTR 100% 5.625 3.938 N METTL16 n/a
7 TRCN0000136815 CCCAAAGTAACGTACACTGAA pLKO.1 701 CDS 100% 4.950 3.465 N METTL16 n/a
8 TRCN0000138614 CGGAGTAACTGTGTCCTTGAA pLKO.1 2593 3UTR 100% 4.950 3.465 N METTL16 n/a
9 TRCN0000134067 GTTTGTTATGAGGTGGAGTTT pLKO.1 2959 3UTR 100% 4.950 3.465 N METTL16 n/a
10 TRCN0000136957 CCTGTACTTACCTACTCACAT pLKO.1 2556 3UTR 100% 4.950 2.970 N METTL16 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3207 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 4216 3UTR 100% 4.950 2.475 Y ERAP2 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3207 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025046.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08916 pDONR223 100% 61.1% 61% None 0_1ins654;782G>A n/a
Download CSV