Transcript: Human XM_017025105.1

PREDICTED: Homo sapiens dephospho-CoA kinase domain containing (DCAKD), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DCAKD (79877)
Length:
2252
CDS:
765..1157

Additional Resources:

NCBI RefSeq record:
XM_017025105.1
NBCI Gene record:
DCAKD (79877)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025105.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377648 CAAGGGTTTCCATGTTCAAAC pLKO_005 1620 3UTR 100% 10.800 15.120 N DCAKD n/a
2 TRCN0000380223 AGGGTTCACTGGGCTTGAATC pLKO_005 1533 3UTR 100% 10.800 8.640 N DCAKD n/a
3 TRCN0000360299 CTTTGGAGTGTATCCTATTTG pLKO_005 1349 3UTR 100% 13.200 9.240 N DCAKD n/a
4 TRCN0000360300 GAAGCACACCGTGGTAGTATA pLKO_005 842 CDS 100% 13.200 9.240 N DCAKD n/a
5 TRCN0000382037 TGCTGGAGAACGGCGACATAA pLKO_005 526 5UTR 100% 13.200 9.240 N DCAKD n/a
6 TRCN0000078714 CCGCTACGTGATTCTGGATAT pLKO.1 782 CDS 100% 10.800 7.560 N DCAKD n/a
7 TRCN0000078717 CCTGCTGTTTGAGACCAAGAA pLKO.1 806 CDS 100% 4.950 3.465 N DCAKD n/a
8 TRCN0000078713 GCCAGGTAACACATCCTGTTT pLKO.1 1213 3UTR 100% 4.950 3.465 N DCAKD n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1251 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025105.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04143 pDONR223 100% 55.2% 54.3% None 0_1ins285;5_8delGCCC;13_13delAins23 n/a
2 ccsbBroad304_04143 pLX_304 0% 55.2% 54.3% V5 0_1ins285;5_8delGCCC;13_13delAins23 n/a
3 TRCN0000468920 ACGAGTGCAACTTTACATCTACAT pLX_317 50.2% 55.2% 54.3% V5 0_1ins285;5_8delGCCC;13_13delAins23 n/a
4 ccsbBroadEn_15156 pDONR223 0% 55.2% 54.3% None 0_1ins285;5_8delGCCC;13_13delAins23 n/a
5 ccsbBroad304_15156 pLX_304 0% 55.2% 54.3% V5 0_1ins285;5_8delGCCC;13_13delAins23 n/a
6 TRCN0000465914 ACAGGCTATCTCGGTAAAGTGATA pLX_317 35.9% 55.2% 54.3% V5 0_1ins285;5_8delGCCC;13_13delAins23 n/a
Download CSV