Transcript: Human XM_017025183.1

PREDICTED: Homo sapiens nudE neurodevelopment protein 1 like 1 (NDEL1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NDEL1 (81565)
Length:
2703
CDS:
348..1520

Additional Resources:

NCBI RefSeq record:
XM_017025183.1
NBCI Gene record:
NDEL1 (81565)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025183.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330531 AGTCAGACTCGGGCCATTAAG pLKO_005 690 CDS 100% 13.200 10.560 N NDEL1 n/a
2 TRCN0000176500 CTTTCCTTGAAGTATAAGCAA pLKO.1 450 CDS 100% 3.000 2.400 N Ndel1 n/a
3 TRCN0000330533 ATATGAAGTGGAGGCATTAAA pLKO_005 605 CDS 100% 15.000 10.500 N NDEL1 n/a
4 TRCN0000136925 CGGGAAAGACAACAGGAAGTA pLKO.1 936 CDS 100% 4.950 3.465 N NDEL1 n/a
5 TRCN0000135136 CCGAAAGCTATACCAAATGGT pLKO.1 1080 CDS 100% 3.000 2.100 N NDEL1 n/a
6 TRCN0000330473 CCGAAAGCTATACCAAATGGT pLKO_005 1080 CDS 100% 3.000 2.100 N NDEL1 n/a
7 TRCN0000330532 CAGAGTTGGAGGCACAATTAG pLKO_005 532 CDS 100% 13.200 7.920 N NDEL1 n/a
8 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 2350 3UTR 100% 4.950 2.475 Y CFLAR n/a
9 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 2350 3UTR 100% 4.950 2.475 Y C19orf31 n/a
10 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 2348 3UTR 100% 4.950 2.475 Y ERN2 n/a
11 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 2348 3UTR 100% 4.950 2.475 Y P3H4 n/a
12 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 2348 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025183.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09072 pDONR223 100% 85% 78.6% None (many diffs) n/a
2 ccsbBroad304_09072 pLX_304 0% 85% 78.6% V5 (many diffs) n/a
3 TRCN0000492231 GGCGTTCTGCTTGCGCATATTTCC pLX_317 40.2% 85% 78.6% V5 (many diffs) n/a
Download CSV