Transcript: Human XM_017025260.1

PREDICTED: Homo sapiens src kinase associated phosphoprotein 1 (SKAP1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SKAP1 (8631)
Length:
1280
CDS:
97..894

Additional Resources:

NCBI RefSeq record:
XM_017025260.1
NBCI Gene record:
SKAP1 (8631)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025260.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416504 GAGACTGGGTGGATCAAATAA pLKO_005 410 CDS 100% 15.000 21.000 N SKAP1 n/a
2 TRCN0000435304 GAGGTCTCTTCTACTACTATG pLKO_005 224 CDS 100% 10.800 15.120 N SKAP1 n/a
3 TRCN0000006368 CGTTCATCAAACCTGTTACTA pLKO.1 1078 3UTR 100% 5.625 7.875 N SKAP1 n/a
4 TRCN0000006370 GCTCAAGAACTTGATAACGTA pLKO.1 118 CDS 100% 3.000 4.200 N SKAP1 n/a
5 TRCN0000435563 GATGAAACCCAGGAAATATAT pLKO_005 890 CDS 100% 15.000 10.500 N SKAP1 n/a
6 TRCN0000255054 AGAGACTGGGTGGATCAAATA pLKO_005 409 CDS 100% 13.200 9.240 N Skap1 n/a
7 TRCN0000255055 ATAGGCGCAGCTATGAGTTTA pLKO_005 365 CDS 100% 13.200 9.240 N Skap1 n/a
8 TRCN0000006369 CCAGATGAAGAGCATGATCTA pLKO.1 637 CDS 100% 4.950 3.465 N SKAP1 n/a
9 TRCN0000006372 CCTGCGAAGAGATTCCAAGAA pLKO.1 315 CDS 100% 4.950 3.465 N SKAP1 n/a
10 TRCN0000006371 CCAGATGAACTGTCCTTCCAA pLKO.1 742 CDS 100% 3.000 2.100 N SKAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025260.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01973 pDONR223 100% 73.5% 73.5% None 0_1ins282;594_596delAGT n/a
2 ccsbBroad304_01973 pLX_304 0% 73.5% 73.5% V5 0_1ins282;594_596delAGT n/a
3 TRCN0000475261 ATATCACTATGCGTGGTTATGCAA pLX_317 46% 73.5% 73.5% V5 0_1ins282;594_596delAGT n/a
Download CSV