Transcript: Human XM_017025279.1

PREDICTED: Homo sapiens kinase suppressor of ras 1 (KSR1), transcript variant X19, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KSR1 (8844)
Length:
2309
CDS:
204..1829

Additional Resources:

NCBI RefSeq record:
XM_017025279.1
NBCI Gene record:
KSR1 (8844)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147076 GTTGGAGTTCATTGGATGCG pXPR_003 CGG 561 35% 4 -0.0077 KSR1 KSR1 77860
2 BRDN0001146294 TGGGTTGGATGATGTCGGGA pXPR_003 AGG 1387 85% 10 -0.1464 KSR1 KSR1 77859
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025279.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006230 GTGCCAGAAGAGCATGATATT pLKO.1 1289 CDS 100% 13.200 10.560 N KSR1 n/a
2 TRCN0000338414 GTGCCAGAAGAGCATGATATT pLKO_005 1289 CDS 100% 13.200 10.560 N KSR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025279.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14915 pDONR223 72.3% 42.8% 49.7% None (many diffs) n/a
2 ccsbBroad304_14915 pLX_304 0% 42.8% 49.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000481419 ATCCCTCTAAATTAGTAATAGAAA pLX_317 19.1% 42.8% 49.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV