Construct: ORF TRCN0000481419
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018878.3_s317c1
- Derived from:
- ccsbBroadEn_14915
- DNA Barcode:
- ATCCCTCTAAATTAGTAATAGAAA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- KSR1 (8844)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481419
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8844 | KSR1 | kinase suppressor of ras 1 | NM_014238.2 | 98.7% | 61.8% | (many diffs) |
| 2 | human | 8844 | KSR1 | kinase suppressor of ras 1 | XM_017025271.1 | 95.7% | 59.9% | (many diffs) |
| 3 | human | 8844 | KSR1 | kinase suppressor of ras 1 | XM_017025272.1 | 95.7% | 59.9% | (many diffs) |
| 4 | human | 8844 | KSR1 | kinase suppressor of ras 1 | XM_017025273.1 | 95.7% | 59.9% | (many diffs) |
| 5 | human | 8844 | KSR1 | kinase suppressor of ras 1 | XM_017025274.2 | 95.7% | 59.9% | (many diffs) |
| 6 | human | 8844 | KSR1 | kinase suppressor of ras 1 | XM_017025275.2 | 95.7% | 59.9% | (many diffs) |
| 7 | human | 8844 | KSR1 | kinase suppressor of ras 1 | XM_017025276.1 | 95.7% | 59.9% | (many diffs) |
| 8 | human | 8844 | KSR1 | kinase suppressor of ras 1 | XM_017025270.2 | 93.5% | 58.5% | (many diffs) |
| 9 | human | 8844 | KSR1 | kinase suppressor of ras 1 | XM_011525430.2 | 83.7% | 52.3% | (many diffs) |
| 10 | human | 8844 | KSR1 | kinase suppressor of ras 1 | XM_011525431.2 | 83.5% | 52.4% | (many diffs) |
| 11 | human | 8844 | KSR1 | kinase suppressor of ras 1 | XM_011525429.2 | 81.5% | 51% | (many diffs) |
| 12 | human | 8844 | KSR1 | kinase suppressor of ras 1 | XM_017025267.1 | 80% | 49.5% | (many diffs) |
| 13 | human | 8844 | KSR1 | kinase suppressor of ras 1 | NM_001367810.1 | 79.1% | 48.5% | (many diffs) |
| 14 | human | 8844 | KSR1 | kinase suppressor of ras 1 | XM_006722154.3 | 77.6% | 47% | (many diffs) |
| 15 | human | 8844 | KSR1 | kinase suppressor of ras 1 | XR_934587.3 | 72.3% | (many diffs) | |
| 16 | human | 8844 | KSR1 | kinase suppressor of ras 1 | XM_017025277.1 | 72.2% | 35.8% | (many diffs) |
| 17 | human | 8844 | KSR1 | kinase suppressor of ras 1 | XM_017025278.1 | 70.4% | 34.7% | (many diffs) |
| 18 | human | 8844 | KSR1 | kinase suppressor of ras 1 | XR_934588.3 | 70.3% | (many diffs) | |
| 19 | human | 8844 | KSR1 | kinase suppressor of ras 1 | XM_017025279.1 | 42.8% | 49.7% | (many diffs) |
| 20 | human | 8844 | KSR1 | kinase suppressor of ras 1 | XM_017025280.2 | 40.8% | 48.7% | (many diffs) |
| 21 | human | 8844 | KSR1 | kinase suppressor of ras 1 | XR_002958082.1 | 34.5% | (many diffs) | |
| 22 | mouse | 16706 | Ksr1 | kinase suppressor of ras 1 | XM_011248772.2 | 77.5% | 48.1% | (many diffs) |
| 23 | mouse | 16706 | Ksr1 | kinase suppressor of ras 1 | XM_011248775.2 | 77.5% | 48.1% | (many diffs) |
| 24 | mouse | 16706 | Ksr1 | kinase suppressor of ras 1 | XM_011248774.3 | 75.5% | 46.9% | (many diffs) |
| 25 | mouse | 16706 | Ksr1 | kinase suppressor of ras 1 | XM_011248773.3 | 72.7% | 45.2% | (many diffs) |
| 26 | mouse | 16706 | Ksr1 | kinase suppressor of ras 1 | NM_001348207.1 | 71.2% | 43.5% | (many diffs) |
| 27 | mouse | 16706 | Ksr1 | kinase suppressor of ras 1 | XM_006532335.4 | 70.3% | 43.6% | (many diffs) |
| 28 | mouse | 16706 | Ksr1 | kinase suppressor of ras 1 | XM_006532334.4 | 68.3% | 42.5% | (many diffs) |
| 29 | mouse | 16706 | Ksr1 | kinase suppressor of ras 1 | NM_013571.3 | 66.9% | 40.9% | (many diffs) |
| 30 | mouse | 16706 | Ksr1 | kinase suppressor of ras 1 | XM_011248770.3 | 66.5% | 41.3% | (many diffs) |
| 31 | mouse | 16706 | Ksr1 | kinase suppressor of ras 1 | XM_011248771.3 | 65% | 39.8% | (many diffs) |
| 32 | mouse | 16706 | Ksr1 | kinase suppressor of ras 1 | XR_388355.4 | 57.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1599
- ORF length:
- 1530
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaatgaggcc aaggtgaagg agacgctgcg gcgctgtggg gccagcgggg 121 atgagtgtgg ccgtctgcag tatgccctca cctgcctgcg gaaggtgaca ggcctgggag 181 gggagcacaa ggaggactcc agttggagtt cattggatgc gcggcgggaa agtggctcag 241 ggccttccac ggacaccctc tcagcagcca gcctgccctg gcccccaggg agctcccagc 301 tgggcagagc aggcaacagc gtccagggcc cacgctccat ctccgtgtca gctctgcccg 361 cctcagactc ccccaccccc agcttcagtg agggcctctc agacacctgt attcccctgc 421 acgccagcgg ccggctgacc ccccgtgccc tgcacagctt catcaccccg cccaccacac 481 cccagctgcg acggcacacc aagctgaagc caccacggac gcccccccca cccagccgca 541 aggtcttcca gctgctgccc agcttcccca cactcacccg gagcaagtcc catgagtctc 601 agctggggaa ccgcattgat gacgtctcct cgatgaggtt tgatctctcg catggatccc 661 cacagatggt acggagggat atcgggctgt cggtgacgca caggttctcc accaagtcct 721 ggctgtcgca gtctgccacg tgtgccagag agcatgatat ttggagtgaa gtgcaagcat 781 tgcagttgaa gtgtcacaac aaatgtacaa agagcccctg ctgtagatat ctctgcacta 841 actcggcttc gaggacagaa tctgtcccct cggacatcac caacccggtg gacagagcag 901 ccgaacccca ttttggaacc ctccccaaag cactgacaaa gaaggagcac cctccggcca 961 tgaatcacct ggactccagc agcaaccctt cctccaccac ctcctccaca ccctcctcac 1021 cggcgccctt cccgacatca tccaacccat ccagcgccac cacgcccccc aacccctcac 1081 ctggccagcg ggacagcagg ttcaacttcc cagctgccta cttcattcat catagacagc 1141 agtttatctt tccagtgcca tctgctggcc attgctggaa atgcctcctt attgcagaaa 1201 gtttaaagga aaacgctttc aacatttcag cctttgcaca cgcagccccg ctccctgaag 1261 ctgccgacgg tacccggctc gatgaccagc cgaaagcaga tgtgttggaa gctcacgaag 1321 cggaggctga ggagccagag gctggcaagt cagaggcaga agacgatgag gacgaggtgg 1381 acgacttgcc gagctctcgc cggccctggc ggggccccat ctctcgcaag gccagccaga 1441 ccagcgtgta cctgcaggag tgggacatcc ccttcgagca ggtagagctg ggcgagccca 1501 tcgggcaggg ccgctggggc cgggtgcacc gcggccgctg gcatggcgag tggcccatcg 1561 cctgcttgaa gatggacggc ccacaaccca gacccacctg aagctctcan ngaaagaggt 1621 gatgaactac cggcagacgc ggcatgagaa cgtggtgctc ttcatggggg cctgcatgaa 1681 cccgccccac cctggccatt atcaccagct tctgcaaggg gcggacgttg cactcgtttg 1741 tgagggaccc caagacgtct ctggacatca acaagacgag gcaaatcgct caggagatca 1801 tcaagggcat gggatatctt catgccaagg gcatcgtaca caaagatctc aaatctaaga 1861 acgtcttcta tgacaacggc aaggtggtca tcacagactt cgggctgttt gggatcTCAG 1921 GCGTGGTCCG AGAGGGACGG CGTGAGAACC AGCTAAAGCT GTCCCACGAC TGGCTGTGCT 1981 ATCTGGCCCC TGAGATTGTA CGCGAGATGA CCCCCGGGAA GGACGAGGAT CAGCTGCCAT 2041 TCTCCAAAGC TGCTGATGTC TATGCATTTG GGACTGTTTG GTATGAGCTG CAAGCAAGAG 2101 ACTGGCCCTT GAAGAACCAG GCTGCAGAGG CATCCATCTG GCAGATTGGA AGCGGGGAAG 2161 GAATGAAGCG TGTCCTGACT TCTGTCAGCT TGGGGAAGGA AGTCAGTGAG ATCCTGTCGG 2221 CCTGCTGGGC TTTCGACCTG CAGGAGAGAC CCAGCTTCAG CCTGCTGATG GACATGCTGG 2281 AGAAACTTCC CAAGCTGAAC CGGCGGCTCT CCCACCCTGG ACACTTCTGG AAGTCAGCTG 2341 AGTTGTTGCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 2401 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 2461 CTTGGCTTTA TATATCTTGT GGAAAGGACG AATCCCTCTA AATTAGTAAT AGAAAACGCG 2521 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt