Transcript: Human XM_017025377.1

PREDICTED: Homo sapiens golgi SNAP receptor complex member 1 (GOSR1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GOSR1 (9527)
Length:
694
CDS:
127..633

Additional Resources:

NCBI RefSeq record:
XM_017025377.1
NBCI Gene record:
GOSR1 (9527)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025377.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379866 ATGGAAGACGCGACAGGTATA pLKO_005 407 CDS 100% 10.800 15.120 N GOSR1 n/a
2 TRCN0000060386 CGATTGAGATTGAACAACTTT pLKO.1 488 CDS 100% 5.625 7.875 N GOSR1 n/a
3 TRCN0000060383 GCGACAGGTATAGTTCTGATA pLKO.1 416 CDS 100% 4.950 6.930 N GOSR1 n/a
4 TRCN0000379765 AGCAAACTATGTACAAGTTAC pLKO_005 367 CDS 100% 10.800 7.560 N GOSR1 n/a
5 TRCN0000381471 GGATCAAGCCAAGACAGAATG pLKO_005 454 CDS 100% 10.800 7.560 N GOSR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025377.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14022 pDONR223 100% 50.3% 49.3% None (many diffs) n/a
2 ccsbBroad304_14022 pLX_304 0% 50.3% 49.3% V5 (many diffs) n/a
3 TRCN0000468369 TGGCCCGAAACGGGTGGCTGAATA pLX_317 69.9% 50.3% 49.3% V5 (many diffs) n/a
Download CSV