Transcript: Human XM_017025600.2

PREDICTED: Homo sapiens dystrobrevin alpha (DTNA), transcript variant X29, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DTNA (1837)
Length:
1558
CDS:
181..1305

Additional Resources:

NCBI RefSeq record:
XM_017025600.2
NBCI Gene record:
DTNA (1837)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025600.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053909 CCTGCTAAGAAGCTGACTAAT pLKO.1 1063 CDS 100% 13.200 9.240 N DTNA n/a
2 TRCN0000301123 CCTGCTAAGAAGCTGACTAAT pLKO_005 1063 CDS 100% 13.200 9.240 N DTNA n/a
3 TRCN0000053911 CGATGCCAACAGTGTCACAAT pLKO.1 949 CDS 100% 4.950 3.465 N DTNA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025600.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00464 pDONR223 100% 99.1% 99.1% None 1002_1010delTGATACTTG n/a
2 ccsbBroad304_00464 pLX_304 0% 99.1% 99.1% V5 1002_1010delTGATACTTG n/a
3 TRCN0000474295 CCCAAGTAGACGGGTGTAGCACGA pLX_317 37.6% 99.1% 99.1% V5 1002_1010delTGATACTTG n/a
Download CSV