Transcript: Human XM_017025734.1

PREDICTED: Homo sapiens ATPase phospholipid transporting 9B (putative) (ATP9B), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATP9B (374868)
Length:
5079
CDS:
300..3503

Additional Resources:

NCBI RefSeq record:
XM_017025734.1
NBCI Gene record:
ATP9B (374868)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025734.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436606 TCGGCTGACGAAAGCGCTATT pLKO_005 1436 CDS 100% 10.800 15.120 N ATP9B n/a
2 TRCN0000051589 CCACTAATGATGTCTGAAGAA pLKO.1 462 CDS 100% 4.950 6.930 N ATP9B n/a
3 TRCN0000051590 CGAATCCATGAAGCCGTGAAA pLKO.1 1920 CDS 100% 4.950 6.930 N ATP9B n/a
4 TRCN0000051591 GCTGTTACTATGACACGGGAA pLKO.1 873 CDS 100% 2.160 3.024 N ATP9B n/a
5 TRCN0000434860 GTAATAGGTGTTGTCATTTAT pLKO_005 1338 CDS 100% 15.000 12.000 N ATP9B n/a
6 TRCN0000429622 ACATGGGCAAAGCGGTGTATG pLKO_005 1588 CDS 100% 10.800 8.640 N ATP9B n/a
7 TRCN0000429064 GAGGATGAGTCTGCGCATTTG pLKO_005 432 CDS 100% 10.800 7.560 N ATP9B n/a
8 TRCN0000051592 GCACCATTGTTGCATCAGGTA pLKO.1 1315 CDS 100% 2.640 1.848 N ATP9B n/a
9 TRCN0000101561 GCTCACAGTTTGTACCAGCAT pLKO.1 802 CDS 100% 2.640 1.848 N Atp9b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025734.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16162 pDONR223 0% 12.7% 12.7% None 1_159del;562_582del;589_3201del n/a
2 ccsbBroad304_16162 pLX_304 0% 12.7% 12.7% V5 1_159del;562_582del;589_3201del n/a
3 TRCN0000481472 TCATAGCGTGATGCCATTGCCAGA pLX_317 82.2% 12.7% 12.7% V5 1_159del;562_582del;589_3201del n/a
Download CSV