Transcript: Human XM_017025919.1

PREDICTED: Homo sapiens GRB2 associated regulator of MAPK1 subtype 1 (GAREM1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GAREM1 (64762)
Length:
3072
CDS:
91..2133

Additional Resources:

NCBI RefSeq record:
XM_017025919.1
NBCI Gene record:
GAREM1 (64762)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025919.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426148 GTTCGACATCGATGAGTATTC pLKO_005 1089 CDS 100% 10.800 15.120 N GAREM1 n/a
2 TRCN0000136021 GCACCGCTATAAGTTTGTGAA pLKO.1 894 CDS 100% 4.950 6.930 N GAREM1 n/a
3 TRCN0000136049 GCTTCAGGTGAATGCAATGAA pLKO.1 487 CDS 100% 5.625 4.500 N GAREM1 n/a
4 TRCN0000415739 AGAACAGATGTGATCAGTTTA pLKO_005 1514 CDS 100% 13.200 9.240 N GAREM1 n/a
5 TRCN0000427905 TGACTATCTGCTGATTCATTC pLKO_005 240 CDS 100% 10.800 7.560 N GAREM1 n/a
6 TRCN0000138004 GCAGCAGTGAAGTCTTCAGAT pLKO.1 1594 CDS 100% 4.950 2.970 N GAREM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025919.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12484 pDONR223 100% 73.6% 65.5% None (many diffs) n/a
2 TRCN0000492035 TACGCTATCTCAAATTAAGCATGT pLX_317 14.3% 73.6% 65.5% V5 (many diffs) n/a
3 ccsbBroadEn_12483 pDONR223 100% 71.4% 67.7% None (many diffs) n/a
Download CSV