Transcript: Human XM_017025976.1

PREDICTED: Homo sapiens coiled-coil domain containing 102B (CCDC102B), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC102B (79839)
Length:
3792
CDS:
257..1795

Additional Resources:

NCBI RefSeq record:
XM_017025976.1
NBCI Gene record:
CCDC102B (79839)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025976.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140334 CATGCAAACAACCGAGTGGAT pLKO.1 1592 CDS 100% 2.640 2.112 N CCDC102B n/a
2 TRCN0000412775 ACACCAACAAATGGGATATTT pLKO_005 444 CDS 100% 15.000 10.500 N CCDC102B n/a
3 TRCN0000122397 GAGTGGGACAAGAGGGAAATA pLKO.1 1340 CDS 100% 13.200 9.240 N CCDC102B n/a
4 TRCN0000424111 GATCTTCCAGATGCAACAATC pLKO_005 298 CDS 100% 10.800 7.560 N CCDC102B n/a
5 TRCN0000144350 CAAACTCTCAAAGTCCTGATT pLKO.1 1461 CDS 100% 4.950 3.465 N CCDC102B n/a
6 TRCN0000122610 GAACCTTCAACATGCCTACTA pLKO.1 1528 CDS 100% 4.950 3.465 N CCDC102B n/a
7 TRCN0000139006 CCTGAATCAGATCCGTAAGCT pLKO.1 1702 CDS 100% 3.000 2.100 N CCDC102B n/a
8 TRCN0000122034 GCAATAAATCTGCCTTTGGAA pLKO.1 989 CDS 100% 3.000 2.100 N CCDC102B n/a
9 TRCN0000144256 CAGACAATACCAGGCAAATAT pLKO.1 1558 CDS 100% 15.000 9.000 N CCDC102B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025976.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12630 pDONR223 100% 57.6% 57.6% None 1_648del;1536_1537insTGG n/a
2 ccsbBroad304_12630 pLX_304 0% 57.6% 57.6% V5 1_648del;1536_1537insTGG n/a
3 TRCN0000466818 GAACCGTGTAGAAGCAACGATACA pLX_317 40.3% 57.6% 57.6% V5 1_648del;1536_1537insTGG n/a
4 ccsbBroadEn_12629 pDONR223 100% 26.9% 22.3% None (many diffs) n/a
5 ccsbBroad304_12629 pLX_304 0% 26.9% 22.3% V5 (many diffs) n/a
6 TRCN0000472837 TTACGTCGAAGTCGCAATGCACCG pLX_317 23.3% 26.9% 22.3% V5 (many diffs) n/a
Download CSV