Transcript: Human XM_017026035.2

PREDICTED: Homo sapiens maestro (MRO), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MRO (83876)
Length:
3785
CDS:
72..818

Additional Resources:

NCBI RefSeq record:
XM_017026035.2
NBCI Gene record:
MRO (83876)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026035.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147552 GCAGTTCTTCTACGCAAATAA pLKO.1 788 CDS 100% 15.000 21.000 N MRO n/a
2 TRCN0000130957 CAGGTTAAGCAGACACGAGAT pLKO.1 591 CDS 100% 4.050 5.670 N MRO n/a
3 TRCN0000129619 CCTCCTGATCCATTTACAGGA pLKO.1 614 CDS 100% 0.264 0.370 N MRO n/a
4 TRCN0000147666 GCAGGTACACACTTTCTTTAA pLKO.1 1056 3UTR 100% 13.200 10.560 N MRO n/a
5 TRCN0000414995 GTATTTGCTATTGATACTTTG pLKO_005 1250 3UTR 100% 10.800 7.560 N MRO n/a
6 TRCN0000149115 GAATACAGCTTCCAGAGTGAA pLKO.1 708 CDS 100% 4.950 3.465 N MRO n/a
7 TRCN0000128908 GAAAGCTAACACATAGGGAAA pLKO.1 1599 3UTR 100% 4.050 2.835 N MRO n/a
8 TRCN0000131052 CCACTATCATCCAGAGATCCT pLKO.1 767 CDS 100% 2.640 1.848 N MRO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026035.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09125 pDONR223 100% 99.5% 99.1% None 117G>C;400A>G;429C>T n/a
2 ccsbBroad304_09125 pLX_304 0% 99.5% 99.1% V5 117G>C;400A>G;429C>T n/a
3 TRCN0000467637 TGAGCAAGTGAAACAAACTGTCTT pLX_317 48.5% 99.5% 99.1% V5 117G>C;400A>G;429C>T n/a
Download CSV