Transcript: Human XM_017026178.1

PREDICTED: Homo sapiens protein phosphatase 1 regulatory subunit 13 like (PPP1R13L), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPP1R13L (10848)
Length:
3238
CDS:
196..2682

Additional Resources:

NCBI RefSeq record:
XM_017026178.1
NBCI Gene record:
PPP1R13L (10848)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026178.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022209 CCAACTACTCTATCGTGGATT pLKO.1 2207 CDS 100% 4.950 6.930 N PPP1R13L n/a
2 TRCN0000281331 CCAACTACTCTATCGTGGATT pLKO_005 2207 CDS 100% 4.950 6.930 N PPP1R13L n/a
3 TRCN0000022210 GCCTCAAAGGAGTAAAGTCTA pLKO.1 2661 CDS 100% 4.950 6.930 N PPP1R13L n/a
4 TRCN0000281252 GCCTCAAAGGAGTAAAGTCTA pLKO_005 2661 CDS 100% 4.950 6.930 N PPP1R13L n/a
5 TRCN0000022212 CCCTACCCACAAGAAACAGTA pLKO.1 1803 CDS 100% 4.950 3.465 N PPP1R13L n/a
6 TRCN0000297948 CCCTACCCACAAGAAACAGTA pLKO_005 1803 CDS 100% 4.950 3.465 N PPP1R13L n/a
7 TRCN0000022213 GCGGAACTACTTCGGGCTGTT pLKO.1 2628 CDS 100% 1.350 0.945 N PPP1R13L n/a
8 TRCN0000281333 GCGGAACTACTTCGGGCTGTT pLKO_005 2628 CDS 100% 1.350 0.945 N PPP1R13L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026178.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07691 pDONR223 100% 99.9% 99.8% None 592C>T n/a
2 ccsbBroad304_07691 pLX_304 0% 99.9% 99.8% V5 592C>T n/a
3 TRCN0000479632 TGCTTTCCACCTATATGGGCGGCA pLX_317 12.1% 99.9% 99.8% V5 592C>T n/a
Download CSV