Transcript: Human XM_017026216.1

PREDICTED: Homo sapiens leukocyte immunoglobulin like receptor B4 (LILRB4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LILRB4 (11006)
Length:
1942
CDS:
93..1562

Additional Resources:

NCBI RefSeq record:
XM_017026216.1
NBCI Gene record:
LILRB4 (11006)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026216.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056867 GATACCGCTGTTACTATCGCA pLKO.1 499 CDS 100% 0.750 1.050 N LILRB4 n/a
2 TRCN0000435294 CACAATGAGTTAACTGATAAA pLKO_005 1772 3UTR 100% 13.200 9.240 N LILRB4 n/a
3 TRCN0000056864 TCCTCTTGTGACCTCAGGAAA pLKO.1 608 CDS 100% 4.950 3.465 N LILRB4 n/a
4 TRCN0000056863 GCTCATAGTCTCAGGATCCTT pLKO.1 857 CDS 100% 3.000 2.100 N LILRB4 n/a
5 TRCN0000056865 CTCGGGAGTACCGTCTGGATA pLKO.1 379 CDS 100% 1.650 1.155 N LILRB4 n/a
6 TRCN0000056866 GCCCAGTGTCTATGCCACTCT pLKO.1 1529 CDS 100% 0.880 0.616 N LILRB4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026216.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07723 pDONR223 100% 91% 90.8% None (many diffs) n/a
2 ccsbBroad304_07723 pLX_304 0% 91% 90.8% V5 (many diffs) n/a
3 TRCN0000478308 ATCGACTTCGATGCCTGGACTCCC pLX_317 25% 91% 90.8% V5 (many diffs) n/a
4 ccsbBroadEn_11582 pDONR223 100% 54.7% 47.3% None (many diffs) n/a
5 ccsbBroad304_11582 pLX_304 0% 54.7% 47.3% V5 (many diffs) n/a
6 TRCN0000476797 GACTTACTCCCCGGATCTCGTAGG pLX_317 13.1% 54.7% 47.3% V5 (many diffs) n/a
Download CSV